Incidental Mutation 'R6566:Runx2'
ID522713
Institutional Source Beutler Lab
Gene Symbol Runx2
Ensembl Gene ENSMUSG00000039153
Gene Namerunt related transcription factor 2
Synonymspolyomavirus enhancer binding factor 2 (PEBP2), Pebpa2a, AML3, Osf2, PEBP2aA, PEBP2 alpha A, Cbfa1, SL3-3 enhancer factor 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6566 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location44495987-44814797 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 44814488 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050630] [ENSMUST00000113568] [ENSMUST00000113571] [ENSMUST00000127798] [ENSMUST00000129416] [ENSMUST00000159943] [ENSMUST00000160673] [ENSMUST00000162629]
Predicted Effect probably benign
Transcript: ENSMUST00000050630
SMART Domains Protein: ENSMUSP00000050783
Gene: ENSMUSG00000038954

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Pfam:TFIID-18kDa 24 116 4.5e-38 PFAM
low complexity region 274 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113568
Predicted Effect probably benign
Transcript: ENSMUST00000113571
SMART Domains Protein: ENSMUSP00000109201
Gene: ENSMUSG00000039153

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
coiled coil region 45 89 N/A INTRINSIC
Pfam:Runt 106 240 9.2e-83 PFAM
Pfam:RunxI 434 528 7.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127798
SMART Domains Protein: ENSMUSP00000121148
Gene: ENSMUSG00000038954

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Pfam:TFIID-18kDa 24 116 9.3e-39 PFAM
low complexity region 274 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129416
SMART Domains Protein: ENSMUSP00000120197
Gene: ENSMUSG00000038954

DomainStartEndE-ValueType
Pfam:TFIID-18kDa 17 109 1e-38 PFAM
low complexity region 267 287 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130623
Predicted Effect probably benign
Transcript: ENSMUST00000159943
SMART Domains Protein: ENSMUSP00000124918
Gene: ENSMUSG00000039153

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
coiled coil region 45 89 N/A INTRINSIC
Pfam:Runt 106 240 9.2e-83 PFAM
Pfam:RunxI 434 528 7.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160672
Predicted Effect probably null
Transcript: ENSMUST00000160673
SMART Domains Protein: ENSMUSP00000123743
Gene: ENSMUSG00000039153

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
coiled coil region 113 157 N/A INTRINSIC
Pfam:Runt 177 306 3.9e-75 PFAM
Pfam:RunxI 505 596 3.2e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161489
Predicted Effect probably benign
Transcript: ENSMUST00000162629
SMART Domains Protein: ENSMUSP00000124374
Gene: ENSMUSG00000039153

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
coiled coil region 45 89 N/A INTRINSIC
Pfam:Runt 106 240 3.5e-83 PFAM
Pfam:RunxI 412 506 2.7e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: This gene encodes a member of the runt domain-containing family of transcription factors. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, decreased body weight, abnormal hematopoiesis, and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik C T 3: 88,711,654 T555M probably damaging Het
Abcd2 A G 15: 91,191,118 I164T probably damaging Het
Adad2 C T 8: 119,614,232 P164S probably benign Het
Adcy3 T A 12: 4,194,324 L278H probably damaging Het
Aldh16a1 A C 7: 45,143,227 D670E probably benign Het
Bcat1 A G 6: 145,015,484 M131T probably damaging Het
D11Wsu47e C T 11: 113,687,998 P73L probably damaging Het
Dcstamp T C 15: 39,754,336 F47S possibly damaging Het
Dsg1b T C 18: 20,397,442 F385L probably damaging Het
Exoc8 A C 8: 124,896,044 L528R probably damaging Het
Fat4 T C 3: 38,957,126 V2125A possibly damaging Het
Hecw1 T C 13: 14,297,283 D600G probably damaging Het
Ice2 G A 9: 69,416,229 V669I probably benign Het
Lsr T A 7: 30,972,083 Y75F possibly damaging Het
Mrps30 C A 13: 118,387,126 V37L probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr815 T A 10: 129,902,078 I211L probably benign Het
Pign A G 1: 105,638,181 probably null Het
Plcd3 A G 11: 103,073,800 Y582H probably damaging Het
Rad9b A G 5: 122,352,567 W29R probably damaging Het
Rb1cc1 T A 1: 6,249,092 F912I probably benign Het
Rgs16 C T 1: 153,743,800 S184L unknown Het
Serpina1f T A 12: 103,693,535 I163F probably damaging Het
Serpina9 T C 12: 103,997,037 E404G possibly damaging Het
Slc4a4 T C 5: 89,149,333 S511P possibly damaging Het
Speg A T 1: 75,388,463 E390V probably damaging Het
Syne3 A G 12: 104,946,707 V614A probably benign Het
Tmc5 T C 7: 118,647,844 S524P probably damaging Het
Tuba4a G A 1: 75,217,286 T51I probably damaging Het
Tymp T A 15: 89,373,600 T421S probably benign Het
Uvssa A G 5: 33,392,176 R394G possibly damaging Het
Wdr7 T G 18: 63,755,055 I533S possibly damaging Het
Zbtb5 G A 4: 44,994,508 T292M probably damaging Het
Zfp944 T G 17: 22,339,745 K174Q possibly damaging Het
Other mutations in Runx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02020:Runx2 APN 17 44658599 missense probably damaging 1.00
IGL02029:Runx2 APN 17 44658687 nonsense probably null
IGL02084:Runx2 APN 17 44724829 missense probably damaging 1.00
R0040:Runx2 UTSW 17 44608254 missense possibly damaging 0.58
R0627:Runx2 UTSW 17 44658505 intron probably benign
R0944:Runx2 UTSW 17 44608236 missense probably damaging 0.99
R1514:Runx2 UTSW 17 44735337 missense possibly damaging 0.54
R2069:Runx2 UTSW 17 44735342 missense probably benign 0.19
R3976:Runx2 UTSW 17 44610079 missense possibly damaging 0.91
R4686:Runx2 UTSW 17 44639685 missense probably damaging 1.00
R4911:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R5241:Runx2 UTSW 17 44639777 nonsense probably null
R5526:Runx2 UTSW 17 44724862 missense probably damaging 1.00
R6874:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R6875:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R6980:Runx2 UTSW 17 44735316 missense possibly damaging 0.65
R7008:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7009:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7057:Runx2 UTSW 17 44814537 missense probably null
R7085:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7175:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7176:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7177:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7181:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7231:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7232:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7254:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7267:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7835:Runx2 UTSW 17 44608236 missense probably damaging 0.99
R7918:Runx2 UTSW 17 44608236 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCTTGCAGCCTTAAACTG -3'
(R):5'- TCTCTCCAGTAATAGTGCTTGC -3'

Sequencing Primer
(F):5'- GCTTGCAGCCTTAAACTGAAAATAC -3'
(R):5'- GTGTGAATGCTTCATTCGC -3'
Posted On2018-06-06