Incidental Mutation 'R6566:Dsg1b'
ID522715
Institutional Source Beutler Lab
Gene Symbol Dsg1b
Ensembl Gene ENSMUSG00000061928
Gene Namedesmoglein 1 beta
SynonymsDsg5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6566 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location20376729-20410196 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20397442 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 385 (F385L)
Ref Sequence ENSEMBL: ENSMUSP00000076026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076737]
Predicted Effect probably damaging
Transcript: ENSMUST00000076737
AA Change: F385L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076026
Gene: ENSMUSG00000061928
AA Change: F385L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.45e-14 SMART
CA 179 267 3.11e-21 SMART
CA 290 384 6.29e-8 SMART
CA 407 491 3.92e-1 SMART
low complexity region 523 541 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 593 601 N/A INTRINSIC
Pfam:Cadherin_C 662 784 1.6e-10 PFAM
low complexity region 789 802 N/A INTRINSIC
low complexity region 884 896 N/A INTRINSIC
low complexity region 984 1006 N/A INTRINSIC
Meta Mutation Damage Score 0.4244 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik C T 3: 88,711,654 T555M probably damaging Het
Abcd2 A G 15: 91,191,118 I164T probably damaging Het
Adad2 C T 8: 119,614,232 P164S probably benign Het
Adcy3 T A 12: 4,194,324 L278H probably damaging Het
Aldh16a1 A C 7: 45,143,227 D670E probably benign Het
Bcat1 A G 6: 145,015,484 M131T probably damaging Het
D11Wsu47e C T 11: 113,687,998 P73L probably damaging Het
Dcstamp T C 15: 39,754,336 F47S possibly damaging Het
Exoc8 A C 8: 124,896,044 L528R probably damaging Het
Fat4 T C 3: 38,957,126 V2125A possibly damaging Het
Hecw1 T C 13: 14,297,283 D600G probably damaging Het
Ice2 G A 9: 69,416,229 V669I probably benign Het
Lsr T A 7: 30,972,083 Y75F possibly damaging Het
Mrps30 C A 13: 118,387,126 V37L probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr815 T A 10: 129,902,078 I211L probably benign Het
Pign A G 1: 105,638,181 probably null Het
Plcd3 A G 11: 103,073,800 Y582H probably damaging Het
Rad9b A G 5: 122,352,567 W29R probably damaging Het
Rb1cc1 T A 1: 6,249,092 F912I probably benign Het
Rgs16 C T 1: 153,743,800 S184L unknown Het
Runx2 A G 17: 44,814,488 probably null Het
Serpina1f T A 12: 103,693,535 I163F probably damaging Het
Serpina9 T C 12: 103,997,037 E404G possibly damaging Het
Slc4a4 T C 5: 89,149,333 S511P possibly damaging Het
Speg A T 1: 75,388,463 E390V probably damaging Het
Syne3 A G 12: 104,946,707 V614A probably benign Het
Tmc5 T C 7: 118,647,844 S524P probably damaging Het
Tuba4a G A 1: 75,217,286 T51I probably damaging Het
Tymp T A 15: 89,373,600 T421S probably benign Het
Uvssa A G 5: 33,392,176 R394G possibly damaging Het
Wdr7 T G 18: 63,755,055 I533S possibly damaging Het
Zbtb5 G A 4: 44,994,508 T292M probably damaging Het
Zfp944 T G 17: 22,339,745 K174Q possibly damaging Het
Other mutations in Dsg1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dsg1b APN 18 20396476 missense probably damaging 1.00
IGL00675:Dsg1b APN 18 20391918 nonsense probably null
IGL01071:Dsg1b APN 18 20409215 missense probably damaging 1.00
IGL01589:Dsg1b APN 18 20409594 missense probably damaging 1.00
IGL01729:Dsg1b APN 18 20405238 missense possibly damaging 0.66
IGL01753:Dsg1b APN 18 20397849 splice site probably benign
IGL02560:Dsg1b APN 18 20409178 missense possibly damaging 0.80
IGL02654:Dsg1b APN 18 20409262 missense probably damaging 1.00
IGL02726:Dsg1b APN 18 20399485 missense probably benign
IGL03272:Dsg1b APN 18 20397389 missense probably benign 0.25
IGL03342:Dsg1b APN 18 20409460 missense probably benign 0.09
IGL02835:Dsg1b UTSW 18 20392014 missense possibly damaging 0.66
R0080:Dsg1b UTSW 18 20397367 missense probably damaging 1.00
R0133:Dsg1b UTSW 18 20404878 missense probably damaging 0.96
R0455:Dsg1b UTSW 18 20396025 missense probably benign 0.02
R0498:Dsg1b UTSW 18 20409333 missense possibly damaging 0.95
R0518:Dsg1b UTSW 18 20388164 missense probably benign 0.00
R1418:Dsg1b UTSW 18 20397430 nonsense probably null
R1429:Dsg1b UTSW 18 20390195 missense probably damaging 1.00
R1450:Dsg1b UTSW 18 20409184 missense probably damaging 1.00
R1569:Dsg1b UTSW 18 20396480 missense probably damaging 1.00
R1674:Dsg1b UTSW 18 20399521 missense probably benign
R1934:Dsg1b UTSW 18 20395906 missense probably damaging 1.00
R2004:Dsg1b UTSW 18 20396475 missense probably damaging 0.99
R2191:Dsg1b UTSW 18 20409618 makesense probably null
R2192:Dsg1b UTSW 18 20409618 makesense probably null
R2927:Dsg1b UTSW 18 20405251 missense probably benign 0.23
R3777:Dsg1b UTSW 18 20399587 missense probably damaging 1.00
R3801:Dsg1b UTSW 18 20390203 missense probably damaging 1.00
R4205:Dsg1b UTSW 18 20408821 missense probably damaging 1.00
R4718:Dsg1b UTSW 18 20397929 missense probably damaging 0.98
R4853:Dsg1b UTSW 18 20408736 missense probably benign 0.01
R4853:Dsg1b UTSW 18 20390132 critical splice acceptor site probably null
R4981:Dsg1b UTSW 18 20408868 missense possibly damaging 0.66
R5125:Dsg1b UTSW 18 20397503 missense probably damaging 1.00
R5178:Dsg1b UTSW 18 20397503 missense probably damaging 1.00
R5213:Dsg1b UTSW 18 20395930 missense probably damaging 1.00
R5450:Dsg1b UTSW 18 20409064 missense probably damaging 1.00
R5605:Dsg1b UTSW 18 20399539 missense probably benign
R5778:Dsg1b UTSW 18 20409222 missense possibly damaging 0.66
R5808:Dsg1b UTSW 18 20408725 missense probably damaging 1.00
R6144:Dsg1b UTSW 18 20396419 missense possibly damaging 0.92
R6185:Dsg1b UTSW 18 20399486 missense probably benign
R6268:Dsg1b UTSW 18 20388163 missense probably benign 0.01
R6291:Dsg1b UTSW 18 20404791 missense possibly damaging 0.71
R6342:Dsg1b UTSW 18 20390243 missense probably damaging 1.00
R6449:Dsg1b UTSW 18 20394441 missense possibly damaging 0.82
R6817:Dsg1b UTSW 18 20394405 missense probably damaging 1.00
R7235:Dsg1b UTSW 18 20399423 missense probably benign 0.01
R7857:Dsg1b UTSW 18 20396463 missense probably benign 0.06
R7940:Dsg1b UTSW 18 20396463 missense probably benign 0.06
R7990:Dsg1b UTSW 18 20405210 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGATTTCTCTGTCCTCTGAACTG -3'
(R):5'- TTGCCAAATCCACTTTGTGC -3'

Sequencing Primer
(F):5'- CCTCTGAACTGTTTTCTTAGAGTATG -3'
(R):5'- GCCAAATCCACTTTGTGCTCATTC -3'
Posted On2018-06-06