Incidental Mutation 'R6567:Dennd2c'
ID522723
Institutional Source Beutler Lab
Gene Symbol Dennd2c
Ensembl Gene ENSMUSG00000007379
Gene NameDENN/MADD domain containing 2C
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6567 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location103102604-103169769 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103132019 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 161 (A161V)
Ref Sequence ENSEMBL: ENSMUSP00000127187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172288] [ENSMUST00000173206]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166143
Predicted Effect probably benign
Transcript: ENSMUST00000172288
AA Change: A161V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000127187
Gene: ENSMUSG00000007379
AA Change: A161V

DomainStartEndE-ValueType
uDENN 481 571 1.01e-25 SMART
DENN 578 762 3.36e-77 SMART
dDENN 806 873 1.15e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173206
AA Change: A161V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000134008
Gene: ENSMUSG00000007379
AA Change: A161V

DomainStartEndE-ValueType
uDENN 424 514 1.01e-25 SMART
DENN 521 705 3.36e-77 SMART
dDENN 749 816 1.15e-20 SMART
Meta Mutation Damage Score 0.0679 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik T A 9: 35,839,115 Y87F probably benign Het
9930111J21Rik1 T C 11: 48,948,123 T546A probably benign Het
Ahnak G T 19: 9,008,806 V2485L probably benign Het
C2cd5 T C 6: 143,031,248 I722M possibly damaging Het
Clca4b A G 3: 144,932,339 I54T possibly damaging Het
Dmxl1 T C 18: 49,859,179 Y331H probably damaging Het
Dnajc2 G A 5: 21,766,678 R247W probably damaging Het
Dock3 T C 9: 106,896,747 T380A probably benign Het
Evc2 T C 5: 37,419,164 V1044A probably benign Het
Ints2 T C 11: 86,226,661 H745R probably benign Het
Kcnh1 T A 1: 192,277,104 M322K probably benign Het
Lrrc6 C T 15: 66,438,379 V347I probably benign Het
Mmp19 A G 10: 128,796,406 T191A probably benign Het
Mms19 A G 19: 41,949,767 probably null Het
Ncapd3 T C 9: 27,067,004 I833T possibly damaging Het
Nif3l1 T A 1: 58,455,630 C253S probably benign Het
Olfr589 A T 7: 103,154,928 I273K possibly damaging Het
Pcsk1 T A 13: 75,130,070 I584N probably damaging Het
Pms2 T C 5: 143,928,968 V50A probably damaging Het
Rptor A G 11: 119,896,012 I1268V probably benign Het
Scap C T 9: 110,383,562 R1021W probably damaging Het
Soga3 G T 10: 29,147,283 V209F probably benign Het
Sos1 A T 17: 80,433,503 Y618N probably damaging Het
Tesk2 C T 4: 116,792,164 A157V probably damaging Het
Tm6sf2 C A 8: 70,075,524 H108N probably damaging Het
Trank1 T C 9: 111,347,521 V287A probably benign Het
Tsks A T 7: 44,953,881 Q369L probably damaging Het
Vmn2r58 T C 7: 41,865,249 T99A probably benign Het
Wbp11 C T 6: 136,820,539 S294N probably benign Het
Zfp608 T C 18: 54,897,556 Y1104C probably damaging Het
Zfp759 T A 13: 67,139,086 S234T probably benign Het
Other mutations in Dennd2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01763:Dennd2c APN 3 103156908 missense probably damaging 1.00
IGL01791:Dennd2c APN 3 103166425 missense probably benign 0.19
IGL02100:Dennd2c APN 3 103153675 missense probably damaging 0.98
IGL02119:Dennd2c APN 3 103137243 missense probably damaging 0.99
IGL02395:Dennd2c APN 3 103157765 missense probably benign 0.00
IGL02631:Dennd2c APN 3 103156071 missense possibly damaging 0.56
IGL02895:Dennd2c APN 3 103137203 missense possibly damaging 0.76
R1749:Dennd2c UTSW 3 103132036 missense possibly damaging 0.92
R1931:Dennd2c UTSW 3 103133252 missense probably benign 0.32
R1964:Dennd2c UTSW 3 103166491 missense probably damaging 1.00
R1972:Dennd2c UTSW 3 103131698 missense probably benign 0.01
R1973:Dennd2c UTSW 3 103131698 missense probably benign 0.01
R2025:Dennd2c UTSW 3 103131689 missense possibly damaging 0.71
R2350:Dennd2c UTSW 3 103132001 missense probably benign 0.00
R2373:Dennd2c UTSW 3 103156842 missense probably damaging 0.99
R4555:Dennd2c UTSW 3 103131886 missense probably benign 0.00
R4916:Dennd2c UTSW 3 103131824 missense probably benign 0.00
R5560:Dennd2c UTSW 3 103161555 missense probably damaging 1.00
R6291:Dennd2c UTSW 3 103131609 nonsense probably null
R6395:Dennd2c UTSW 3 103149224 critical splice donor site probably null
R6681:Dennd2c UTSW 3 103131661 missense probably benign 0.01
R7106:Dennd2c UTSW 3 103131577 missense possibly damaging 0.82
R7162:Dennd2c UTSW 3 103156107 missense probably damaging 1.00
R7514:Dennd2c UTSW 3 103163062 missense probably benign 0.00
R7591:Dennd2c UTSW 3 103133345 missense possibly damaging 0.51
R7698:Dennd2c UTSW 3 103165043 missense possibly damaging 0.65
R8069:Dennd2c UTSW 3 103165130 missense probably damaging 1.00
R8086:Dennd2c UTSW 3 103133345 missense possibly damaging 0.51
R8247:Dennd2c UTSW 3 103152321 missense probably damaging 0.99
R8347:Dennd2c UTSW 3 103157709 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGGATGTCAAAAGCCGAGATC -3'
(R):5'- TTCGGGATCCTGAGAAGAGG -3'

Sequencing Primer
(F):5'- AGAGTGTAGAGGCTCCCAC -3'
(R):5'- CACAGTACTTTTGATCACAGTTCC -3'
Posted On2018-06-06