Incidental Mutation 'R6567:Ints2'
ID522774
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Nameintegrator complex subunit 2
Synonyms2810417D08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6567 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location86210681-86257575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86226661 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 745 (H745R)
Ref Sequence ENSEMBL: ENSMUSP00000103674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
Predicted Effect probably benign
Transcript: ENSMUST00000018212
AA Change: H745R

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: H745R

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108039
AA Change: H745R

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: H745R

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect unknown
Transcript: ENSMUST00000134828
AA Change: H58R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146421
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik T A 9: 35,839,115 Y87F probably benign Het
9930111J21Rik1 T C 11: 48,948,123 T546A probably benign Het
Ahnak G T 19: 9,008,806 V2485L probably benign Het
C2cd5 T C 6: 143,031,248 I722M possibly damaging Het
Clca4b A G 3: 144,932,339 I54T possibly damaging Het
Dennd2c C T 3: 103,132,019 A161V probably benign Het
Dmxl1 T C 18: 49,859,179 Y331H probably damaging Het
Dnajc2 G A 5: 21,766,678 R247W probably damaging Het
Dock3 T C 9: 106,896,747 T380A probably benign Het
Evc2 T C 5: 37,419,164 V1044A probably benign Het
Kcnh1 T A 1: 192,277,104 M322K probably benign Het
Lrrc6 C T 15: 66,438,379 V347I probably benign Het
Mmp19 A G 10: 128,796,406 T191A probably benign Het
Mms19 A G 19: 41,949,767 probably null Het
Ncapd3 T C 9: 27,067,004 I833T possibly damaging Het
Nif3l1 T A 1: 58,455,630 C253S probably benign Het
Olfr589 A T 7: 103,154,928 I273K possibly damaging Het
Pcsk1 T A 13: 75,130,070 I584N probably damaging Het
Pms2 T C 5: 143,928,968 V50A probably damaging Het
Rptor A G 11: 119,896,012 I1268V probably benign Het
Scap C T 9: 110,383,562 R1021W probably damaging Het
Soga3 G T 10: 29,147,283 V209F probably benign Het
Sos1 A T 17: 80,433,503 Y618N probably damaging Het
Tesk2 C T 4: 116,792,164 A157V probably damaging Het
Tm6sf2 C A 8: 70,075,524 H108N probably damaging Het
Trank1 T C 9: 111,347,521 V287A probably benign Het
Tsks A T 7: 44,953,881 Q369L probably damaging Het
Vmn2r58 T C 7: 41,865,249 T99A probably benign Het
Wbp11 C T 6: 136,820,539 S294N probably benign Het
Zfp608 T C 18: 54,897,556 Y1104C probably damaging Het
Zfp759 T A 13: 67,139,086 S234T probably benign Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86233135 missense probably damaging 1.00
IGL02490:Ints2 APN 11 86233183 missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86215578 missense probably damaging 1.00
IGL03396:Ints2 APN 11 86213062 missense probably damaging 0.99
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0355:Ints2 UTSW 11 86234749 missense probably benign 0.00
R0389:Ints2 UTSW 11 86248851 missense probably damaging 1.00
R0631:Ints2 UTSW 11 86233196 missense probably benign 0.02
R0944:Ints2 UTSW 11 86244463 missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1269:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1270:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1396:Ints2 UTSW 11 86249248 missense probably damaging 0.98
R1474:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1503:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1840:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1987:Ints2 UTSW 11 86217800 missense probably benign 0.03
R1990:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86243001 missense probably benign 0.41
R4056:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4057:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4569:Ints2 UTSW 11 86256198 missense probably damaging 1.00
R4585:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4586:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4806:Ints2 UTSW 11 86256209 missense probably benign 0.10
R4929:Ints2 UTSW 11 86212653 missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86256200 missense probably damaging 1.00
R5064:Ints2 UTSW 11 86249274 missense probably damaging 1.00
R5270:Ints2 UTSW 11 86215795 missense probably damaging 1.00
R5621:Ints2 UTSW 11 86242947 missense probably benign 0.32
R5875:Ints2 UTSW 11 86238312 missense probably benign 0.04
R5908:Ints2 UTSW 11 86215545 critical splice donor site probably null
R5914:Ints2 UTSW 11 86222174 missense probably benign 0.03
R5941:Ints2 UTSW 11 86250972 missense probably benign 0.01
R5975:Ints2 UTSW 11 86226748 missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86238468 missense probably damaging 1.00
R6091:Ints2 UTSW 11 86236603 missense probably damaging 0.96
R6209:Ints2 UTSW 11 86225058 missense probably damaging 1.00
R6764:Ints2 UTSW 11 86212779 missense probably benign 0.00
R7033:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R7132:Ints2 UTSW 11 86217754 missense probably benign 0.26
R7337:Ints2 UTSW 11 86217842 missense probably benign 0.00
R7410:Ints2 UTSW 11 86233226 missense probably benign 0.02
R7483:Ints2 UTSW 11 86215618 missense probably damaging 1.00
R7503:Ints2 UTSW 11 86232055 missense probably benign
R7804:Ints2 UTSW 11 86212663 missense possibly damaging 0.92
R7845:Ints2 UTSW 11 86238263 missense possibly damaging 0.93
R7875:Ints2 UTSW 11 86213062 missense probably damaging 0.99
R7918:Ints2 UTSW 11 86222217 missense probably damaging 1.00
R7922:Ints2 UTSW 11 86244627 missense probably benign 0.29
R8058:Ints2 UTSW 11 86255353 missense probably benign 0.05
R8134:Ints2 UTSW 11 86212660 missense probably damaging 1.00
R8189:Ints2 UTSW 11 86215570 missense probably damaging 1.00
R8295:Ints2 UTSW 11 86225088 missense probably damaging 0.97
R8348:Ints2 UTSW 11 86255423 missense probably benign
R8448:Ints2 UTSW 11 86255423 missense probably benign
R8784:Ints2 UTSW 11 86222137 missense probably damaging 1.00
R8784:Ints2 UTSW 11 86225115 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGGACACTAATCTGGAACATTAC -3'
(R):5'- ACTGAGAGTCCAGTTAACTTCCTG -3'

Sequencing Primer
(F):5'- CAAGTACATTGCCTTGATCTACTG -3'
(R):5'- AGAGTCCAGTTAACTTCCTGTTTTG -3'
Posted On2018-06-06