Mutagenetix > Incidental Mutations

Incidental Mutation 'R6490:Col6a4'

522775

Institutional Source

Beutler Lab

Gene Symbol

Col6a4

Ensembl Gene

ENSMUSG00000032572

Gene Name

collagen, type VI, alpha 4

Synonyms

Vwa6, 1110001D15Rik, EG235580, Dvwa

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6490 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

105989454-106096783 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 106074992 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 569 (L569*)

Ref Sequence

ENSEMBL: ENSMUSP00000112472 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000121963]

Predicted Effect

probably null
Transcript: ENSMUST00000121963
AA Change: L569*

SMART Domains

Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572
AA Change: L569*

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWA	32	211	2.44e-35	SMART
VWA	233	410	8.67e-50	SMART
VWA	428	604	2.74e-29	SMART
VWA	632	816	4.78e-20	SMART
VWA	847	1019	3.02e-40	SMART
VWA	1028	1204	3.17e-43	SMART
VWA	1210	1391	4.73e-1	SMART
low complexity region	1444	1462	N/A	INTRINSIC
PDB:3HR2\|B	1469	1593	3e-7	PDB
low complexity region	1594	1622	N/A	INTRINSIC
low complexity region	1625	1643	N/A	INTRINSIC
low complexity region	1649	1671	N/A	INTRINSIC
Pfam:Collagen	1684	1748	1.4e-9	PFAM
VWA	1774	1953	2.18e-14	SMART
VWA	1980	2174	1.89e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137847

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.6%

Validation Efficiency

99% (69/70)

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018B08Rik	T	G	8: 121,540,554	K38T	probably benign	Het
4932415D10Rik	A	T	10: 82,289,304	L2624Q	possibly damaging	Het
Abca13	A	G	11: 9,298,661	T2803A	probably benign	Het
Adam23	A	G	1: 63,557,454	D565G	probably damaging	Het
Adcy3	A	G	12: 4,212,150	T1067A	probably damaging	Het
Agrn	A	T	4: 156,167,362	Y1921*	probably null	Het
Apc2	A	G	10: 80,313,923	N1604D	probably benign	Het
Atxn7	A	T	14: 14,089,446	R321*	probably null	Het
Axin1	T	A	17: 26,142,994	I104N	probably damaging	Het
Bahd1	T	C	2: 118,917,138	S413P	probably benign	Het
Baz2b	C	T	2: 59,901,729	C2024Y	probably damaging	Het
Cacna1i	T	A	15: 80,378,247	V1388E	probably damaging	Het
Ccdc129	A	G	6: 55,976,420	D907G	probably damaging	Het
Ces4a	G	A	8: 105,149,458	V544M	probably benign	Het
Cntn3	G	A	6: 102,278,340	T199I	probably damaging	Het
Ctnna2	A	G	6: 77,143,909	I12T	probably benign	Het
Dhx37	A	G	5: 125,419,132	M754T	probably benign	Het
Dmrt1	T	A	19: 25,546,031	S249T	possibly damaging	Het
Ell	G	T	8: 70,572,903	S59I	probably damaging	Het
Fam89a	G	A	8: 124,741,243	S110F	probably damaging	Het
Fer1l4	A	C	2: 156,047,914	F278V	possibly damaging	Het
Fyn	T	C	10: 39,551,402	I427T	probably damaging	Het
Galnt14	T	C	17: 73,525,370	D250G	probably damaging	Het
Glp1r	T	C	17: 30,924,572	V194A	probably damaging	Het
Glt1d1	T	A	5: 127,644,296		probably null	Het
Gm7995	A	G	14: 42,311,370	K69R	probably benign	Het
Grip1	A	G	10: 119,986,424	T379A	possibly damaging	Het
Gtpbp2	G	T	17: 46,168,221	A570S	probably benign	Het
Hmcn1	T	C	1: 150,583,278	I5192V	probably benign	Het
Igfl3	A	T	7: 18,179,919	I65F	possibly damaging	Het
Igsf10	G	T	3: 59,329,571	T1063K	probably benign	Het
Itfg1	A	G	8: 85,740,301	V381A	probably benign	Het
Jmjd8	T	A	17: 25,829,112	V16E	probably benign	Het
Kank1	A	G	19: 25,410,085	Y374C	probably damaging	Het
Kcnma1	C	T	14: 23,336,097	V891I	possibly damaging	Het
Kif20a	C	A	18: 34,629,490	T472K	possibly damaging	Het
Klhl32	A	T	4: 24,711,578		probably benign	Het
Lrrc37a	A	G	11: 103,456,660	S3070P	unknown	Het
Mettl21e	T	G	1: 44,210,265	Y77S	probably damaging	Het
Mlst8	G	T	17: 24,477,961	D82E	probably benign	Het
Mrgprx2	A	T	7: 48,482,869	L67Q	probably damaging	Het
Mylk	T	A	16: 34,929,867	L1192Q	possibly damaging	Het
Myt1l	A	T	12: 29,832,366	Y520F	unknown	Het
Naip2	A	T	13: 100,160,685	W948R	probably benign	Het
Nlrp9a	A	C	7: 26,550,886	K25N	probably damaging	Het
Nsd3	T	C	8: 25,714,185	C414R	probably damaging	Het
Oit3	A	T	10: 59,438,552	V142D	possibly damaging	Het
Olfr171	C	T	16: 19,624,444	V219M	probably benign	Het
P2ry6	T	C	7: 100,938,373	T260A	probably damaging	Het
Papola	A	G	12: 105,804,937	Q87R	probably benign	Het
Pla2g4a	T	A	1: 149,851,335	R557*	probably null	Het
Rgs13	G	T	1: 144,140,838	H56N	probably damaging	Het
Sbf1	T	C	15: 89,304,908	S537G	probably benign	Het
Sntg1	A	C	1: 8,583,284	L243R	possibly damaging	Het
Stam2	T	C	2: 52,720,942	T23A	probably benign	Het
Tbl1xr1	C	A	3: 22,203,977	H467Q	probably damaging	Het
Tmem131l	A	G	3: 83,913,280	S1222P	possibly damaging	Het
Tmem43	G	T	6: 91,478,777	Q123H	probably damaging	Het
Tmem43	T	A	6: 91,486,880	I379N	possibly damaging	Het
Trim43c	A	T	9: 88,844,950	I277F	possibly damaging	Het
Ttn	A	G	2: 76,872,867		probably benign	Het
Vmn1r75	T	A	7: 11,881,076	V245D	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vps53	A	T	11: 76,077,055	M414K	probably benign	Het
Wrn	T	G	8: 33,319,220	L249F	probably benign	Het
Zc3h13	TGATGTCCGGGATGTCCGGGATGTCCGGGATGTCCGGGATGT	TGATGTCCGGGATGTCCGGGATGTCCGGGATGT	14: 75,323,558		probably benign	Het
Zfp454	T	C	11: 50,874,123	N161D	probably benign	Het
Zfp619	G	A	7: 39,534,162	G60R	probably benign	Het
Zfp623	T	A	15: 75,948,459	H421Q	probably damaging	Het
Zfp827	A	G	8: 79,189,977		probably benign	Het

Other mutations in Col6a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00573:Col6a4	APN	9	106022896	missense	probably benign	0.00
IGL00691:Col6a4	APN	9	106057407	missense	probably damaging	1.00
IGL01508:Col6a4	APN	9	106013605	missense	possibly damaging	0.95
IGL01580:Col6a4	APN	9	106068198	missense	probably damaging	1.00
IGL01610:Col6a4	APN	9	106047707	splice site	probably benign
IGL01813:Col6a4	APN	9	106077253	missense	probably damaging	1.00
IGL01933:Col6a4	APN	9	106060114	missense	probably benign	0.04
IGL01973:Col6a4	APN	9	106062894	missense	probably damaging	1.00
IGL02053:Col6a4	APN	9	106063095	missense	possibly damaging	0.92
IGL02063:Col6a4	APN	9	106057418	missense	probably benign	0.01
IGL02065:Col6a4	APN	9	106077103	missense	probably damaging	0.99
IGL02106:Col6a4	APN	9	106063105	missense	possibly damaging	0.95
IGL02220:Col6a4	APN	9	106062942	missense	possibly damaging	0.91
IGL02228:Col6a4	APN	9	106068078	missense	probably benign
IGL02234:Col6a4	APN	9	106013432	missense	possibly damaging	0.92
IGL02294:Col6a4	APN	9	106066732	missense	probably benign	0.04
IGL02314:Col6a4	APN	9	105997156	missense	probably damaging	0.99
IGL03065:Col6a4	APN	9	106041164	splice site	probably benign
IGL03086:Col6a4	APN	9	106082862	splice site	probably benign
IGL03185:Col6a4	APN	9	106019454	missense	probably damaging	0.97
R0092:Col6a4	UTSW	9	106013314	missense	probably benign	0.04
R0095:Col6a4	UTSW	9	106075356	missense	probably benign	0.03
R0230:Col6a4	UTSW	9	106072366	missense	probably benign	0.11
R0359:Col6a4	UTSW	9	105997146	missense	probably benign
R0415:Col6a4	UTSW	9	106075080	missense	probably damaging	0.99
R0433:Col6a4	UTSW	9	106067994	missense	probably damaging	0.99
R0450:Col6a4	UTSW	9	106080547	missense	probably damaging	1.00
R0469:Col6a4	UTSW	9	106080547	missense	probably damaging	1.00
R0490:Col6a4	UTSW	9	106013770	missense	probably damaging	0.99
R0621:Col6a4	UTSW	9	106066791	missense	probably damaging	0.97
R0667:Col6a4	UTSW	9	106029959	splice site	probably benign
R0681:Col6a4	UTSW	9	106067144	nonsense	probably null
R0690:Col6a4	UTSW	9	106028187	splice site	probably benign
R0714:Col6a4	UTSW	9	106017903	unclassified	probably benign
R0788:Col6a4	UTSW	9	106071998	missense	probably benign	0.15
R1036:Col6a4	UTSW	9	106068198	missense	probably damaging	1.00
R1296:Col6a4	UTSW	9	106062853	missense	possibly damaging	0.47
R1386:Col6a4	UTSW	9	106062945	missense	probably benign	0.15
R1484:Col6a4	UTSW	9	106013302	critical splice donor site	probably null
R1528:Col6a4	UTSW	9	106075220	missense	probably damaging	0.99
R1555:Col6a4	UTSW	9	106000886	missense	possibly damaging	0.93
R1622:Col6a4	UTSW	9	105997135	missense	probably benign	0.01
R1653:Col6a4	UTSW	9	106072409	missense	probably damaging	0.99
R1720:Col6a4	UTSW	9	106026472	missense	probably damaging	1.00
R1768:Col6a4	UTSW	9	106080100	missense	probably benign
R1941:Col6a4	UTSW	9	106075010	missense	probably benign	0.00
R2092:Col6a4	UTSW	9	106060331	missense	probably damaging	1.00
R2134:Col6a4	UTSW	9	106066661	missense	probably benign	0.09
R2149:Col6a4	UTSW	9	106076929	missense	probably benign	0.00
R2174:Col6a4	UTSW	9	106060132	missense	probably damaging	0.98
R2204:Col6a4	UTSW	9	106060132	missense	probably damaging	0.98
R2248:Col6a4	UTSW	9	106079959	missense	probably benign	0.15
R2568:Col6a4	UTSW	9	106063076	missense	possibly damaging	0.90
R3750:Col6a4	UTSW	9	106020665	critical splice acceptor site	probably null
R3751:Col6a4	UTSW	9	106072114	missense	probably damaging	0.98
R3776:Col6a4	UTSW	9	106051701	nonsense	probably null
R3872:Col6a4	UTSW	9	106013659	missense	possibly damaging	0.95
R4043:Col6a4	UTSW	9	106072411	nonsense	probably null
R4056:Col6a4	UTSW	9	106026466	missense	probably damaging	0.98
R4212:Col6a4	UTSW	9	106075370	missense	probably benign	0.28
R4417:Col6a4	UTSW	9	106072016	missense	probably damaging	0.99
R4683:Col6a4	UTSW	9	106080130	missense	probably benign	0.00
R4719:Col6a4	UTSW	9	106068252	missense	probably damaging	0.99
R4791:Col6a4	UTSW	9	106080202	missense	possibly damaging	0.68
R4833:Col6a4	UTSW	9	106071979	missense	probably benign	0.00
R4886:Col6a4	UTSW	9	106060072	missense	probably benign	0.00
R4998:Col6a4	UTSW	9	105990778	utr 3 prime	probably benign
R5091:Col6a4	UTSW	9	106075063	missense	probably damaging	1.00
R5113:Col6a4	UTSW	9	106066960	missense	possibly damaging	0.89
R5129:Col6a4	UTSW	9	106013377	missense	probably damaging	0.98
R5231:Col6a4	UTSW	9	106025531	missense	probably damaging	0.96
R5297:Col6a4	UTSW	9	106074867	missense	probably benign	0.02
R5352:Col6a4	UTSW	9	106061544	missense	probably damaging	1.00
R5438:Col6a4	UTSW	9	106013696	missense	possibly damaging	0.95
R5518:Col6a4	UTSW	9	106072188	missense	possibly damaging	0.68
R5657:Col6a4	UTSW	9	106072198	missense	probably damaging	0.99
R5660:Col6a4	UTSW	9	105996116	missense	probably benign	0.01
R5662:Col6a4	UTSW	9	106068001	missense	probably damaging	0.99
R5777:Col6a4	UTSW	9	106013696	missense	possibly damaging	0.95
R5800:Col6a4	UTSW	9	106080275	missense	probably damaging	0.99
R5929:Col6a4	UTSW	9	106063044	missense	probably benign	0.15
R5999:Col6a4	UTSW	9	106067921	missense	probably benign	0.11
R6243:Col6a4	UTSW	9	106013390	missense	possibly damaging	0.95
R6285:Col6a4	UTSW	9	106074986	missense	probably damaging	0.96
R6288:Col6a4	UTSW	9	106068263	missense	probably damaging	0.99
R6361:Col6a4	UTSW	9	106066703	missense	probably benign	0.28
R6485:Col6a4	UTSW	9	106076870	critical splice donor site	probably null
R6537:Col6a4	UTSW	9	106067954	missense	possibly damaging	0.87
R6598:Col6a4	UTSW	9	106000412	missense	probably damaging	0.99
R6643:Col6a4	UTSW	9	106000631	missense	probably damaging	0.96
R6905:Col6a4	UTSW	9	106060318	splice site	probably null
R6944:Col6a4	UTSW	9	106072171	missense	probably damaging	0.98
R7015:Col6a4	UTSW	9	106033755	critical splice donor site	probably null
R7027:Col6a4	UTSW	9	106067014	missense	probably damaging	1.00
R7088:Col6a4	UTSW	9	106000686	missense	possibly damaging	0.56
R7200:Col6a4	UTSW	9	106072249	missense	possibly damaging	0.68
R7238:Col6a4	UTSW	9	106000320	missense	probably damaging	0.99
R7273:Col6a4	UTSW	9	106000457	missense	possibly damaging	0.92
R7335:Col6a4	UTSW	9	106076892	missense	possibly damaging	0.90
R7418:Col6a4	UTSW	9	106022915	missense	probably damaging	1.00
R7421:Col6a4	UTSW	9	106020795	missense	probably damaging	0.99
R7530:Col6a4	UTSW	9	106068390	missense	probably damaging	0.99
R7600:Col6a4	UTSW	9	106066999	missense	possibly damaging	0.86
R7701:Col6a4	UTSW	9	106082888	missense	probably benign	0.17
R7830:Col6a4	UTSW	9	106075390	missense	probably damaging	0.99
R7881:Col6a4	UTSW	9	106080298	missense	probably benign	0.14
R7964:Col6a4	UTSW	9	106080298	missense	probably benign	0.14
RF022:Col6a4	UTSW	9	106077008	missense	probably damaging	0.99
X0025:Col6a4	UTSW	9	106000455	missense	probably damaging	0.99
Z1176:Col6a4	UTSW	9	106000797	missense	probably benign
Z1176:Col6a4	UTSW	9	106000870	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGGTTTACTTACCTTCTACAGCG -3'
(R):5'- TGAGATGGTCGCACACATCC -3'

Sequencing Primer
(F):5'- GTCCTTCGCAACATCAGTCATGAC -3'
(R):5'- GCACACATCCATGAACTCTTGGTG -3'

Posted On

2018-06-06