Mutagenetix > Incidental Mutations

Incidental Mutation 'R6567:Lrrc6'

522782

Institutional Source

Beutler Lab

Gene Symbol

Lrrc6

Ensembl Gene

ENSMUSG00000022375

Gene Name

leucine rich repeat containing 6 (testis)

Synonyms

LRTP

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.153) question?

Stock #

R6567 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

66379858-66500910 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 66438379 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 347 (V347I)

Ref Sequence

ENSEMBL: ENSMUSP00000023006 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023006]

Predicted Effect

probably benign
Transcript: ENSMUST00000023006
AA Change: V347I

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000023006
Gene: ENSMUSG00000022375
AA Change: V347I

Domain	Start	End	E-Value	Type
internal_repeat_1	23	65	8.03e-6	PROSPERO
internal_repeat_1	68	109	8.03e-6	PROSPERO
LRRcap	128	146	2.42e-2	SMART
low complexity region	178	204	N/A	INTRINSIC
low complexity region	277	290	N/A	INTRINSIC
low complexity region	397	408	N/A	INTRINSIC
low complexity region	449	471	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains several leucine-rich repeat domains and appears to be involved in the motility of cilia. Defects in this gene are a cause of primary ciliary dyskinesia-19 (CILD19). Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 4, 11 and 22. [provided by RefSeq, Apr 2016]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110F15Rik	T	A	9: 35,839,115	Y87F	probably benign	Het
9930111J21Rik1	T	C	11: 48,948,123	T546A	probably benign	Het
Ahnak	G	T	19: 9,008,806	V2485L	probably benign	Het
C2cd5	T	C	6: 143,031,248	I722M	possibly damaging	Het
Clca4b	A	G	3: 144,932,339	I54T	possibly damaging	Het
Dennd2c	C	T	3: 103,132,019	A161V	probably benign	Het
Dmxl1	T	C	18: 49,859,179	Y331H	probably damaging	Het
Dnajc2	G	A	5: 21,766,678	R247W	probably damaging	Het
Dock3	T	C	9: 106,896,747	T380A	probably benign	Het
Evc2	T	C	5: 37,419,164	V1044A	probably benign	Het
Ints2	T	C	11: 86,226,661	H745R	probably benign	Het
Kcnh1	T	A	1: 192,277,104	M322K	probably benign	Het
Mmp19	A	G	10: 128,796,406	T191A	probably benign	Het
Mms19	A	G	19: 41,949,767		probably null	Het
Ncapd3	T	C	9: 27,067,004	I833T	possibly damaging	Het
Nif3l1	T	A	1: 58,455,630	C253S	probably benign	Het
Olfr589	A	T	7: 103,154,928	I273K	possibly damaging	Het
Pcsk1	T	A	13: 75,130,070	I584N	probably damaging	Het
Pms2	T	C	5: 143,928,968	V50A	probably damaging	Het
Rptor	A	G	11: 119,896,012	I1268V	probably benign	Het
Scap	C	T	9: 110,383,562	R1021W	probably damaging	Het
Soga3	G	T	10: 29,147,283	V209F	probably benign	Het
Sos1	A	T	17: 80,433,503	Y618N	probably damaging	Het
Tesk2	C	T	4: 116,792,164	A157V	probably damaging	Het
Tm6sf2	C	A	8: 70,075,524	H108N	probably damaging	Het
Trank1	T	C	9: 111,347,521	V287A	probably benign	Het
Tsks	A	T	7: 44,953,881	Q369L	probably damaging	Het
Vmn2r58	T	C	7: 41,865,249	T99A	probably benign	Het
Wbp11	C	T	6: 136,820,539	S294N	probably benign	Het
Zfp608	T	C	18: 54,897,556	Y1104C	probably damaging	Het
Zfp759	T	A	13: 67,139,086	S234T	probably benign	Het

Other mutations in Lrrc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01292:Lrrc6	APN	15	66481233	splice site	probably benign
IGL01313:Lrrc6	APN	15	66380513	missense	probably benign	0.00
IGL01739:Lrrc6	APN	15	66449477	missense	probably benign
IGL01863:Lrrc6	APN	15	66396974	splice site	probably benign
IGL02074:Lrrc6	APN	15	66489490	missense	probably damaging	1.00
IGL02146:Lrrc6	APN	15	66489525	nonsense	probably null
IGL02146:Lrrc6	APN	15	66489526	missense	probably benign	0.08
IGL03194:Lrrc6	APN	15	66442199	missense	probably benign	0.03
droopy	UTSW	15	66447676	splice site	probably benign
R0087:Lrrc6	UTSW	15	66469975	missense	probably benign	0.00
R0178:Lrrc6	UTSW	15	66454101	missense	probably benign	0.05
R0463:Lrrc6	UTSW	15	66380474	missense	probably benign
R0539:Lrrc6	UTSW	15	66447606	missense	probably damaging	0.99
R0608:Lrrc6	UTSW	15	66380474	missense	probably benign
R1124:Lrrc6	UTSW	15	66438415	missense	possibly damaging	0.92
R2209:Lrrc6	UTSW	15	66449551	missense	probably benign	0.00
R2257:Lrrc6	UTSW	15	66437587	splice site	probably benign
R2844:Lrrc6	UTSW	15	66447676	splice site	probably benign
R2867:Lrrc6	UTSW	15	66438408	nonsense	probably null
R2867:Lrrc6	UTSW	15	66438408	nonsense	probably null
R4281:Lrrc6	UTSW	15	66380529	missense	probably benign	0.35
R5163:Lrrc6	UTSW	15	66442218	missense	probably benign	0.01
R5636:Lrrc6	UTSW	15	66500816	utr 5 prime	probably null
R6365:Lrrc6	UTSW	15	66454134	missense	probably benign	0.00
R7751:Lrrc6	UTSW	15	66449563	missense	probably benign	0.00
R7774:Lrrc6	UTSW	15	66449552	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CATCCTTGTGGTGTGGAAGGAC -3'
(R):5'- TGCCAAGTGTACTCGTATGTC -3'

Sequencing Primer
(F):5'- TGTGGAAGGACATGCCCATC -3'
(R):5'- CCTCTGGACTAGGAATAATTTAAGGC -3'

Posted On

2018-06-06