Incidental Mutation 'R6567:Lrrc6'
ID522782
Institutional Source Beutler Lab
Gene Symbol Lrrc6
Ensembl Gene ENSMUSG00000022375
Gene Nameleucine rich repeat containing 6 (testis)
SynonymsLRTP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R6567 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location66379858-66500910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66438379 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 347 (V347I)
Ref Sequence ENSEMBL: ENSMUSP00000023006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023006]
Predicted Effect probably benign
Transcript: ENSMUST00000023006
AA Change: V347I

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023006
Gene: ENSMUSG00000022375
AA Change: V347I

DomainStartEndE-ValueType
internal_repeat_1 23 65 8.03e-6 PROSPERO
internal_repeat_1 68 109 8.03e-6 PROSPERO
LRRcap 128 146 2.42e-2 SMART
low complexity region 178 204 N/A INTRINSIC
low complexity region 277 290 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 449 471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains several leucine-rich repeat domains and appears to be involved in the motility of cilia. Defects in this gene are a cause of primary ciliary dyskinesia-19 (CILD19). Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 4, 11 and 22. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik T A 9: 35,839,115 Y87F probably benign Het
9930111J21Rik1 T C 11: 48,948,123 T546A probably benign Het
Ahnak G T 19: 9,008,806 V2485L probably benign Het
C2cd5 T C 6: 143,031,248 I722M possibly damaging Het
Clca4b A G 3: 144,932,339 I54T possibly damaging Het
Dennd2c C T 3: 103,132,019 A161V probably benign Het
Dmxl1 T C 18: 49,859,179 Y331H probably damaging Het
Dnajc2 G A 5: 21,766,678 R247W probably damaging Het
Dock3 T C 9: 106,896,747 T380A probably benign Het
Evc2 T C 5: 37,419,164 V1044A probably benign Het
Ints2 T C 11: 86,226,661 H745R probably benign Het
Kcnh1 T A 1: 192,277,104 M322K probably benign Het
Mmp19 A G 10: 128,796,406 T191A probably benign Het
Mms19 A G 19: 41,949,767 probably null Het
Ncapd3 T C 9: 27,067,004 I833T possibly damaging Het
Nif3l1 T A 1: 58,455,630 C253S probably benign Het
Olfr589 A T 7: 103,154,928 I273K possibly damaging Het
Pcsk1 T A 13: 75,130,070 I584N probably damaging Het
Pms2 T C 5: 143,928,968 V50A probably damaging Het
Rptor A G 11: 119,896,012 I1268V probably benign Het
Scap C T 9: 110,383,562 R1021W probably damaging Het
Soga3 G T 10: 29,147,283 V209F probably benign Het
Sos1 A T 17: 80,433,503 Y618N probably damaging Het
Tesk2 C T 4: 116,792,164 A157V probably damaging Het
Tm6sf2 C A 8: 70,075,524 H108N probably damaging Het
Trank1 T C 9: 111,347,521 V287A probably benign Het
Tsks A T 7: 44,953,881 Q369L probably damaging Het
Vmn2r58 T C 7: 41,865,249 T99A probably benign Het
Wbp11 C T 6: 136,820,539 S294N probably benign Het
Zfp608 T C 18: 54,897,556 Y1104C probably damaging Het
Zfp759 T A 13: 67,139,086 S234T probably benign Het
Other mutations in Lrrc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Lrrc6 APN 15 66481233 splice site probably benign
IGL01313:Lrrc6 APN 15 66380513 missense probably benign 0.00
IGL01739:Lrrc6 APN 15 66449477 missense probably benign
IGL01863:Lrrc6 APN 15 66396974 splice site probably benign
IGL02074:Lrrc6 APN 15 66489490 missense probably damaging 1.00
IGL02146:Lrrc6 APN 15 66489525 nonsense probably null
IGL02146:Lrrc6 APN 15 66489526 missense probably benign 0.08
IGL03194:Lrrc6 APN 15 66442199 missense probably benign 0.03
droopy UTSW 15 66447676 splice site probably benign
R0087:Lrrc6 UTSW 15 66469975 missense probably benign 0.00
R0178:Lrrc6 UTSW 15 66454101 missense probably benign 0.05
R0463:Lrrc6 UTSW 15 66380474 missense probably benign
R0539:Lrrc6 UTSW 15 66447606 missense probably damaging 0.99
R0608:Lrrc6 UTSW 15 66380474 missense probably benign
R1124:Lrrc6 UTSW 15 66438415 missense possibly damaging 0.92
R2209:Lrrc6 UTSW 15 66449551 missense probably benign 0.00
R2257:Lrrc6 UTSW 15 66437587 splice site probably benign
R2844:Lrrc6 UTSW 15 66447676 splice site probably benign
R2867:Lrrc6 UTSW 15 66438408 nonsense probably null
R2867:Lrrc6 UTSW 15 66438408 nonsense probably null
R4281:Lrrc6 UTSW 15 66380529 missense probably benign 0.35
R5163:Lrrc6 UTSW 15 66442218 missense probably benign 0.01
R5636:Lrrc6 UTSW 15 66500816 utr 5 prime probably null
R6365:Lrrc6 UTSW 15 66454134 missense probably benign 0.00
R7751:Lrrc6 UTSW 15 66449563 missense probably benign 0.00
R7774:Lrrc6 UTSW 15 66449552 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATCCTTGTGGTGTGGAAGGAC -3'
(R):5'- TGCCAAGTGTACTCGTATGTC -3'

Sequencing Primer
(F):5'- TGTGGAAGGACATGCCCATC -3'
(R):5'- CCTCTGGACTAGGAATAATTTAAGGC -3'
Posted On2018-06-06