Incidental Mutation 'R6493:Lax1'
ID522797
Institutional Source Beutler Lab
Gene Symbol Lax1
Ensembl Gene ENSMUSG00000051998
Gene Namelymphocyte transmembrane adaptor 1
SynonymsE430019B13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6493 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location133679091-133690108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 133679792 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 404 (D404N)
Ref Sequence ENSEMBL: ENSMUSP00000131126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169295] [ENSMUST00000189524]
Predicted Effect probably benign
Transcript: ENSMUST00000169295
AA Change: D404N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131126
Gene: ENSMUSG00000051998
AA Change: D404N

DomainStartEndE-ValueType
Pfam:LAX 27 378 2.4e-172 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189524
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit spontaneous germinal center formation and increased IgG1, IgG2a, and IgE levels. T and B cells are hyperresponsive upon engagement of T or B AgRs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,293,878 H934L probably benign Het
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Ampd3 A G 7: 110,795,811 probably null Het
Axdnd1 A T 1: 156,380,813 I485N probably damaging Het
Bscl2 A G 19: 8,839,774 D22G probably damaging Het
Ccdc96 A G 5: 36,486,252 E534G probably damaging Het
Cdc42bpg G T 19: 6,318,455 G1061V probably damaging Het
Cers3 T C 7: 66,743,720 Y26H probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Daxx T A 17: 33,912,371 probably null Het
Egf T C 3: 129,719,088 probably benign Het
Eps15 A G 4: 109,368,948 D629G probably damaging Het
Fancm G A 12: 65,097,488 A575T probably benign Het
Fat4 G A 3: 38,890,887 D1310N probably damaging Het
Gm10424 A G 5: 95,270,825 L104P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Grxcr2 G A 18: 41,998,701 P101L possibly damaging Het
Hsd17b12 A T 2: 94,043,883 I225N probably damaging Het
Kcnj8 T C 6: 142,566,047 Y278C probably damaging Het
Lama3 G A 18: 12,482,148 probably null Het
Lipg T C 18: 74,948,024 K329E probably damaging Het
Lysmd2 T G 9: 75,635,702 L197R probably damaging Het
Maneal A T 4: 124,857,171 I264N probably damaging Het
Myh4 A G 11: 67,258,629 N1729S probably benign Het
Myl2 A G 5: 122,106,728 N154D possibly damaging Het
Nlrp9c T A 7: 26,382,387 D638V probably damaging Het
Notch1 T C 2: 26,472,098 H74R unknown Het
Olfml3 A T 3: 103,736,207 V286D possibly damaging Het
Olfr1271 G A 2: 90,265,708 H241Y probably damaging Het
Olfr228 T C 2: 86,483,221 I174V possibly damaging Het
Olfr310 T G 7: 86,268,882 K302N probably benign Het
Olfr559 G T 7: 102,724,080 R137S possibly damaging Het
Olfr562-ps1 A G 7: 102,782,396 K307E probably benign Het
Parn A C 16: 13,656,925 F127V probably damaging Het
Pcdhac2 T C 18: 37,144,705 V246A probably damaging Het
Plin2 G A 4: 86,661,987 T90I possibly damaging Het
Podxl C T 6: 31,525,046 C326Y probably damaging Het
Prl8a8 T A 13: 27,507,352 K223* probably null Het
Ptprh T G 7: 4,580,990 E201A possibly damaging Het
Rtn1 A C 12: 72,308,329 V281G probably damaging Het
Scaf8 T C 17: 3,171,119 S294P unknown Het
Shroom3 C A 5: 92,941,561 N723K probably benign Het
Spata22 T C 11: 73,353,746 *312R probably null Het
Stx7 T C 10: 24,185,071 probably null Het
Taar6 T C 10: 23,985,123 D175G probably benign Het
Tbccd1 A C 16: 22,822,466 L387R probably damaging Het
Tecpr1 T C 5: 144,209,974 M525V probably benign Het
Tex10 A T 4: 48,436,450 I756N probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn T C 2: 76,741,997 E24438G probably damaging Het
Wdpcp C T 11: 21,711,631 T301I possibly damaging Het
Zbtb1 C T 12: 76,386,473 T411I probably benign Het
Zcchc11 A G 4: 108,526,805 K1053R probably damaging Het
Zzef1 G A 11: 72,913,303 G2624R probably benign Het
Other mutations in Lax1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Lax1 APN 1 133680399 missense probably benign 0.09
IGL01568:Lax1 APN 1 133680300 missense probably benign 0.00
IGL02352:Lax1 APN 1 133680470 missense possibly damaging 0.95
IGL02359:Lax1 APN 1 133680470 missense possibly damaging 0.95
IGL02449:Lax1 APN 1 133680136 missense probably damaging 0.98
yon UTSW 1 133683036 missense probably benign 0.20
R0391:Lax1 UTSW 1 133680066 missense probably benign 0.24
R1728:Lax1 UTSW 1 133679978 missense probably benign
R1728:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1728:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R1729:Lax1 UTSW 1 133679978 missense probably benign
R1729:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1729:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R1730:Lax1 UTSW 1 133679978 missense probably benign
R1730:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1730:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R1739:Lax1 UTSW 1 133679978 missense probably benign
R1739:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1739:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R1762:Lax1 UTSW 1 133679978 missense probably benign
R1762:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1762:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R1783:Lax1 UTSW 1 133679978 missense probably benign
R1783:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1783:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R1784:Lax1 UTSW 1 133679978 missense probably benign
R1784:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1784:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R1785:Lax1 UTSW 1 133679978 missense probably benign
R1785:Lax1 UTSW 1 133680569 missense probably benign 0.00
R1785:Lax1 UTSW 1 133683634 missense probably damaging 1.00
R2254:Lax1 UTSW 1 133680233 missense probably damaging 0.99
R2906:Lax1 UTSW 1 133688905 start codon destroyed probably null 0.53
R2912:Lax1 UTSW 1 133684053 missense possibly damaging 0.77
R4022:Lax1 UTSW 1 133683036 missense probably benign 0.20
R5234:Lax1 UTSW 1 133680583 missense probably benign 0.02
R5686:Lax1 UTSW 1 133680176 missense probably damaging 1.00
R5695:Lax1 UTSW 1 133680578 missense probably damaging 1.00
R6003:Lax1 UTSW 1 133684096 missense probably benign 0.24
R6362:Lax1 UTSW 1 133680596 missense possibly damaging 0.92
R6494:Lax1 UTSW 1 133680448 missense probably damaging 0.99
R6932:Lax1 UTSW 1 133680158 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TTCCACTCTAAGTGCTATGTGC -3'
(R):5'- TCAAGCGAAGACTCCAGTGAC -3'

Sequencing Primer
(F):5'- TCCCCATAACATAGTGTCGC -3'
(R):5'- ACTCCAGTGACTATGAGACTGTGC -3'
Posted On2018-06-06