Incidental Mutation 'R6493:Axdnd1'
ID 522799
Institutional Source Beutler Lab
Gene Symbol Axdnd1
Ensembl Gene ENSMUSG00000026601
Gene Name axonemal dynein light chain domain containing 1
Synonyms 9430070O13Rik, LOC381304
MMRRC Submission 044625-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R6493 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 156157985-156248743 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 156208383 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 485 (I485N)
Ref Sequence ENSEMBL: ENSMUSP00000148420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177824] [ENSMUST00000178036] [ENSMUST00000213088]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000027895
Predicted Effect probably damaging
Transcript: ENSMUST00000177824
AA Change: I420N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135900
Gene: ENSMUSG00000026601
AA Change: I420N

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 131 314 2.4e-12 PFAM
low complexity region 405 414 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 666 677 N/A INTRINSIC
coiled coil region 787 837 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178036
AA Change: I485N

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000137354
Gene: ENSMUSG00000026601
AA Change: I485N

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 196 380 3.3e-14 PFAM
low complexity region 470 479 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
coiled coil region 889 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179572
Predicted Effect unknown
Transcript: ENSMUST00000180173
AA Change: I288N
Predicted Effect probably damaging
Transcript: ENSMUST00000213088
AA Change: I485N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,184,704 (GRCm39) H934L probably benign Het
Abcb1b G A 5: 8,874,698 (GRCm39) D453N probably damaging Het
Ampd3 A G 7: 110,395,018 (GRCm39) probably null Het
Bscl2 A G 19: 8,817,138 (GRCm39) D22G probably damaging Het
Ccdc96 A G 5: 36,643,596 (GRCm39) E534G probably damaging Het
Cdc42bpg G T 19: 6,368,485 (GRCm39) G1061V probably damaging Het
Cers3 T C 7: 66,393,468 (GRCm39) Y26H probably benign Het
Chd1l G A 3: 97,494,483 (GRCm39) A399V probably damaging Het
Clca4a T A 3: 144,663,059 (GRCm39) T597S probably benign Het
Daxx T A 17: 34,131,345 (GRCm39) probably null Het
Egf T C 3: 129,512,737 (GRCm39) probably benign Het
Eps15 A G 4: 109,226,145 (GRCm39) D629G probably damaging Het
Fancm G A 12: 65,144,262 (GRCm39) A575T probably benign Het
Fat4 G A 3: 38,945,036 (GRCm39) D1310N probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Grxcr2 G A 18: 42,131,766 (GRCm39) P101L possibly damaging Het
Hsd17b12 A T 2: 93,874,228 (GRCm39) I225N probably damaging Het
Kcnj8 T C 6: 142,511,773 (GRCm39) Y278C probably damaging Het
Lama3 G A 18: 12,615,205 (GRCm39) probably null Het
Lax1 C T 1: 133,607,530 (GRCm39) D404N probably benign Het
Lipg T C 18: 75,081,095 (GRCm39) K329E probably damaging Het
Lysmd2 T G 9: 75,542,984 (GRCm39) L197R probably damaging Het
Maneal A T 4: 124,750,964 (GRCm39) I264N probably damaging Het
Myh4 A G 11: 67,149,455 (GRCm39) N1729S probably benign Het
Myl2 A G 5: 122,244,791 (GRCm39) N154D possibly damaging Het
Nlrp9c T A 7: 26,081,812 (GRCm39) D638V probably damaging Het
Notch1 T C 2: 26,362,110 (GRCm39) H74R unknown Het
Olfml3 A T 3: 103,643,523 (GRCm39) V286D possibly damaging Het
Or14c46 T G 7: 85,918,090 (GRCm39) K302N probably benign Het
Or4b12 G A 2: 90,096,052 (GRCm39) H241Y probably damaging Het
Or51a25 G T 7: 102,373,287 (GRCm39) R137S possibly damaging Het
Or51f23c-ps1 A G 7: 102,431,603 (GRCm39) K307E probably benign Het
Or8k41 T C 2: 86,313,565 (GRCm39) I174V possibly damaging Het
Parn A C 16: 13,474,789 (GRCm39) F127V probably damaging Het
Pcdhac2 T C 18: 37,277,758 (GRCm39) V246A probably damaging Het
Plin2 G A 4: 86,580,224 (GRCm39) T90I possibly damaging Het
Podxl C T 6: 31,501,981 (GRCm39) C326Y probably damaging Het
Pramel46 A G 5: 95,418,684 (GRCm39) L104P probably damaging Het
Prl8a8 T A 13: 27,691,335 (GRCm39) K223* probably null Het
Ptprh T G 7: 4,583,989 (GRCm39) E201A possibly damaging Het
Rtn1 A C 12: 72,355,103 (GRCm39) V281G probably damaging Het
Scaf8 T C 17: 3,221,394 (GRCm39) S294P unknown Het
Shroom3 C A 5: 93,089,420 (GRCm39) N723K probably benign Het
Spata22 T C 11: 73,244,572 (GRCm39) *312R probably null Het
Stx7 T C 10: 24,060,969 (GRCm39) probably null Het
Taar6 T C 10: 23,861,021 (GRCm39) D175G probably benign Het
Tbccd1 A C 16: 22,641,216 (GRCm39) L387R probably damaging Het
Tecpr1 T C 5: 144,146,792 (GRCm39) M525V probably benign Het
Tex10 A T 4: 48,436,450 (GRCm39) I756N probably damaging Het
Tfap2d G C 1: 19,174,702 (GRCm39) G52R probably benign Het
Ttn T C 2: 76,572,341 (GRCm39) E24438G probably damaging Het
Tut4 A G 4: 108,384,002 (GRCm39) K1053R probably damaging Het
Wdpcp C T 11: 21,661,631 (GRCm39) T301I possibly damaging Het
Zbtb1 C T 12: 76,433,247 (GRCm39) T411I probably benign Het
Zzef1 G A 11: 72,804,129 (GRCm39) G2624R probably benign Het
Other mutations in Axdnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03058:Axdnd1 APN 1 156,204,233 (GRCm39) missense probably benign 0.41
IGL03075:Axdnd1 APN 1 156,223,012 (GRCm39) missense probably damaging 1.00
IGL03165:Axdnd1 APN 1 156,205,959 (GRCm39) missense probably benign 0.00
R0164:Axdnd1 UTSW 1 156,205,956 (GRCm39) missense possibly damaging 0.93
R0164:Axdnd1 UTSW 1 156,205,956 (GRCm39) missense possibly damaging 0.93
R0739:Axdnd1 UTSW 1 156,208,456 (GRCm39) missense possibly damaging 0.73
R1087:Axdnd1 UTSW 1 156,193,259 (GRCm39) missense probably benign 0.08
R1350:Axdnd1 UTSW 1 156,205,950 (GRCm39) critical splice donor site probably null
R1488:Axdnd1 UTSW 1 156,176,530 (GRCm39) missense probably damaging 1.00
R1493:Axdnd1 UTSW 1 156,174,271 (GRCm39) missense probably benign 0.03
R1845:Axdnd1 UTSW 1 156,204,114 (GRCm39) missense possibly damaging 0.58
R1900:Axdnd1 UTSW 1 156,208,344 (GRCm39) splice site probably null
R2126:Axdnd1 UTSW 1 156,160,784 (GRCm39) missense probably benign 0.03
R2163:Axdnd1 UTSW 1 156,219,573 (GRCm39) missense probably damaging 1.00
R2169:Axdnd1 UTSW 1 156,245,879 (GRCm39) missense probably damaging 1.00
R2380:Axdnd1 UTSW 1 156,193,221 (GRCm39) missense probably benign 0.02
R2568:Axdnd1 UTSW 1 156,220,319 (GRCm39) missense possibly damaging 0.90
R3052:Axdnd1 UTSW 1 156,169,440 (GRCm39) missense probably damaging 0.96
R3053:Axdnd1 UTSW 1 156,169,440 (GRCm39) missense probably damaging 0.96
R3767:Axdnd1 UTSW 1 156,208,428 (GRCm39) missense probably damaging 1.00
R3927:Axdnd1 UTSW 1 156,246,840 (GRCm39) missense probably damaging 1.00
R3936:Axdnd1 UTSW 1 156,159,209 (GRCm39) missense probably benign 0.01
R4829:Axdnd1 UTSW 1 156,204,216 (GRCm39) missense possibly damaging 0.93
R4882:Axdnd1 UTSW 1 156,223,129 (GRCm39) splice site probably null
R4969:Axdnd1 UTSW 1 156,223,075 (GRCm39) missense possibly damaging 0.95
R5091:Axdnd1 UTSW 1 156,247,980 (GRCm39) missense possibly damaging 0.83
R5510:Axdnd1 UTSW 1 156,162,920 (GRCm39) missense probably benign 0.03
R5549:Axdnd1 UTSW 1 156,226,104 (GRCm39) missense probably damaging 1.00
R5587:Axdnd1 UTSW 1 156,178,982 (GRCm39) missense probably damaging 1.00
R5792:Axdnd1 UTSW 1 156,169,459 (GRCm39) missense probably damaging 0.99
R5840:Axdnd1 UTSW 1 156,176,528 (GRCm39) missense probably damaging 1.00
R6187:Axdnd1 UTSW 1 156,193,182 (GRCm39) splice site probably null
R6208:Axdnd1 UTSW 1 156,220,426 (GRCm39) intron probably benign
R6369:Axdnd1 UTSW 1 156,220,315 (GRCm39) missense probably damaging 1.00
R7014:Axdnd1 UTSW 1 156,158,532 (GRCm39) splice site probably null
R7115:Axdnd1 UTSW 1 156,208,446 (GRCm39) missense
R7203:Axdnd1 UTSW 1 156,209,959 (GRCm39) missense probably damaging 0.98
R7352:Axdnd1 UTSW 1 156,210,047 (GRCm39) missense possibly damaging 0.91
R7447:Axdnd1 UTSW 1 156,245,802 (GRCm39) critical splice donor site probably null
R7470:Axdnd1 UTSW 1 156,204,086 (GRCm39) missense
R7686:Axdnd1 UTSW 1 156,223,034 (GRCm39) nonsense probably null
R7793:Axdnd1 UTSW 1 156,166,313 (GRCm39) critical splice donor site probably null
R7809:Axdnd1 UTSW 1 156,220,371 (GRCm39) nonsense probably null
R7882:Axdnd1 UTSW 1 156,225,023 (GRCm39) missense
R8256:Axdnd1 UTSW 1 156,158,236 (GRCm39) missense unknown
R8348:Axdnd1 UTSW 1 156,245,854 (GRCm39) missense probably benign 0.02
R8971:Axdnd1 UTSW 1 156,219,516 (GRCm39) missense
R9207:Axdnd1 UTSW 1 156,215,616 (GRCm39) missense
R9294:Axdnd1 UTSW 1 156,247,917 (GRCm39) nonsense probably null
R9741:Axdnd1 UTSW 1 156,169,385 (GRCm39) missense probably benign 0.18
X0009:Axdnd1 UTSW 1 156,215,649 (GRCm39) missense possibly damaging 0.61
X0067:Axdnd1 UTSW 1 156,204,105 (GRCm39) missense possibly damaging 0.67
Z1176:Axdnd1 UTSW 1 156,176,633 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACAGTGCTCTGGACCAGC -3'
(R):5'- TCCATGTAGCACAGAAAGCC -3'

Sequencing Primer
(F):5'- GCTCTGGACCAGCAATGAGTATTC -3'
(R):5'- GACCCATTTCCTGTGAATTCTTTAAG -3'
Posted On 2018-06-06