Mutagenetix > Incidental Mutations

Incidental Mutation 'R6493:Notch1'

522801

Institutional Source

Beutler Lab

Gene Symbol

Notch1

Ensembl Gene

ENSMUSG00000026923

Gene Name

notch 1

Synonyms

Tan1, 9930111A19Rik, Mis6, Motch A, lin-12, N1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6493 (G1)

Quality Score

201.009

Status

Not validated

Chromosome

Chromosomal Location

26457903-26516663 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 26472098 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 74 (H74R)

Ref Sequence

ENSEMBL: ENSMUSP00000115258 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028288] [ENSMUST00000132820]

AlphaFold

Q01705

Predicted Effect

silent
Transcript: ENSMUST00000028288

SMART Domains

Protein: ENSMUSP00000028288
Gene: ENSMUSG00000026923

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
EGF	23	58	1.63e1	SMART
EGF	62	99	4.29e-5	SMART
EGF	105	139	6.25e-7	SMART
EGF_CA	140	176	1.02e-6	SMART
EGF_CA	178	216	4.21e-13	SMART
EGF	221	255	6.7e-7	SMART
EGF_CA	257	293	6.8e-8	SMART
EGF_CA	295	333	1.16e-10	SMART
EGF_CA	335	371	3.17e-8	SMART
EGF	375	410	5.32e-1	SMART
EGF_CA	412	450	4.59e-14	SMART
EGF_CA	452	488	1.02e-11	SMART
EGF_CA	490	526	4.81e-8	SMART
EGF_CA	528	564	3.19e-13	SMART
EGF_CA	566	601	1.91e-11	SMART
EGF_CA	603	639	1.78e-11	SMART
EGF_CA	641	676	9.62e-8	SMART
EGF_CA	678	714	2.38e-12	SMART
EGF_CA	716	751	5.23e-9	SMART
EGF_CA	753	789	6.25e-7	SMART
EGF_CA	791	827	1.1e-11	SMART
EGF	832	867	2.03e-6	SMART
EGF_CA	869	905	5.73e-15	SMART
EGF_CA	907	943	4.56e-9	SMART
EGF_CA	945	981	1.64e-10	SMART
EGF_CA	983	1019	5.83e-7	SMART
EGF_CA	1021	1057	1.05e-13	SMART
EGF	1062	1095	8.12e-6	SMART
EGF	1100	1143	5.66e-5	SMART
EGF_CA	1145	1181	1.1e-11	SMART
EGF_CA	1183	1219	3.87e-12	SMART
EGF_CA	1221	1265	2.89e-11	SMART
EGF_CA	1267	1305	1.2e-8	SMART
EGF	1310	1346	5.74e-6	SMART
EGF	1351	1384	4.1e-2	SMART
EGF	1390	1426	2.66e-1	SMART
NL	1442	1480	4.08e-16	SMART
NL	1483	1522	1.08e-15	SMART
NL	1523	1562	7.39e-14	SMART
NOD	1566	1622	1.81e-32	SMART
NODP	1660	1722	3.27e-30	SMART
low complexity region	1729	1746	N/A	INTRINSIC
ANK	1870	1912	1.07e2	SMART
ANK	1917	1946	4.82e-3	SMART
ANK	1950	1980	6.71e-2	SMART
ANK	1984	2013	1.23e0	SMART
ANK	2017	2046	9.13e-4	SMART
ANK	2050	2079	2.97e-3	SMART
low complexity region	2205	2222	N/A	INTRINSIC
low complexity region	2364	2395	N/A	INTRINSIC
DUF3454	2453	2517	2.01e-30	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123873

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129506

Predicted Effect

unknown
Transcript: ENSMUST00000132820
AA Change: H74R

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147481

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183922

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 97.3%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor plays a role in the development of numerous cell and tissue types. Mutations in this gene are associated with aortic valve disease, Adams-Oliver syndrome, T-cell acute lymphoblastic leukemia, chronic lymphocytic leukemia, and head and neck squamous cell carcinoma. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in lethality at some point in organogenesis. Lethal phenotype may be affected by genetic background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	T	A	11: 110,293,878	H934L	probably benign	Het
Abcb1b	G	A	5: 8,824,698	D453N	probably damaging	Het
Ampd3	A	G	7: 110,795,811		probably null	Het
Axdnd1	A	T	1: 156,380,813	I485N	probably damaging	Het
Bscl2	A	G	19: 8,839,774	D22G	probably damaging	Het
Ccdc96	A	G	5: 36,486,252	E534G	probably damaging	Het
Cdc42bpg	G	T	19: 6,318,455	G1061V	probably damaging	Het
Cers3	T	C	7: 66,743,720	Y26H	probably benign	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Clca4a	T	A	3: 144,957,298	T597S	probably benign	Het
Daxx	T	A	17: 33,912,371		probably null	Het
Egf	T	C	3: 129,719,088		probably benign	Het
Eps15	A	G	4: 109,368,948	D629G	probably damaging	Het
Fancm	G	A	12: 65,097,488	A575T	probably benign	Het
Fat4	G	A	3: 38,890,887	D1310N	probably damaging	Het
Gm10424	A	G	5: 95,270,825	L104P	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Grxcr2	G	A	18: 41,998,701	P101L	possibly damaging	Het
Hsd17b12	A	T	2: 94,043,883	I225N	probably damaging	Het
Kcnj8	T	C	6: 142,566,047	Y278C	probably damaging	Het
Lama3	G	A	18: 12,482,148		probably null	Het
Lax1	C	T	1: 133,679,792	D404N	probably benign	Het
Lipg	T	C	18: 74,948,024	K329E	probably damaging	Het
Lysmd2	T	G	9: 75,635,702	L197R	probably damaging	Het
Maneal	A	T	4: 124,857,171	I264N	probably damaging	Het
Myh4	A	G	11: 67,258,629	N1729S	probably benign	Het
Myl2	A	G	5: 122,106,728	N154D	possibly damaging	Het
Nlrp9c	T	A	7: 26,382,387	D638V	probably damaging	Het
Olfml3	A	T	3: 103,736,207	V286D	possibly damaging	Het
Olfr1271	G	A	2: 90,265,708	H241Y	probably damaging	Het
Olfr228	T	C	2: 86,483,221	I174V	possibly damaging	Het
Olfr310	T	G	7: 86,268,882	K302N	probably benign	Het
Olfr559	G	T	7: 102,724,080	R137S	possibly damaging	Het
Olfr562-ps1	A	G	7: 102,782,396	K307E	probably benign	Het
Parn	A	C	16: 13,656,925	F127V	probably damaging	Het
Pcdhac2	T	C	18: 37,144,705	V246A	probably damaging	Het
Plin2	G	A	4: 86,661,987	T90I	possibly damaging	Het
Podxl	C	T	6: 31,525,046	C326Y	probably damaging	Het
Prl8a8	T	A	13: 27,507,352	K223*	probably null	Het
Ptprh	T	G	7: 4,580,990	E201A	possibly damaging	Het
Rtn1	A	C	12: 72,308,329	V281G	probably damaging	Het
Scaf8	T	C	17: 3,171,119	S294P	unknown	Het
Shroom3	C	A	5: 92,941,561	N723K	probably benign	Het
Spata22	T	C	11: 73,353,746	*312R	probably null	Het
Stx7	T	C	10: 24,185,071		probably null	Het
Taar6	T	C	10: 23,985,123	D175G	probably benign	Het
Tbccd1	A	C	16: 22,822,466	L387R	probably damaging	Het
Tecpr1	T	C	5: 144,209,974	M525V	probably benign	Het
Tex10	A	T	4: 48,436,450	I756N	probably damaging	Het
Tfap2d	G	C	1: 19,104,478	G52R	probably benign	Het
Ttn	T	C	2: 76,741,997	E24438G	probably damaging	Het
Wdpcp	C	T	11: 21,711,631	T301I	possibly damaging	Het
Zbtb1	C	T	12: 76,386,473	T411I	probably benign	Het
Zcchc11	A	G	4: 108,526,805	K1053R	probably damaging	Het
Zzef1	G	A	11: 72,913,303	G2624R	probably benign	Het

Other mutations in Notch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Notch1	APN	2	26460046	missense	probably damaging	0.98
IGL01343:Notch1	APN	2	26472905	missense	probably benign	0.25
IGL02066:Notch1	APN	2	26460396	missense	possibly damaging	0.71
IGL02158:Notch1	APN	2	26460339	missense	probably damaging	1.00
IGL02541:Notch1	APN	2	26468503	missense	probably benign	0.12
IGL03280:Notch1	APN	2	26477874	intron	probably benign
IGL03338:Notch1	APN	2	26459959	missense	probably benign
Antero	UTSW	2	26476114	missense	possibly damaging	0.96
march	UTSW	2	26469899	missense	probably damaging	0.98
PIT4494001:Notch1	UTSW	2	26466473	missense	probably damaging	1.00
R0013:Notch1	UTSW	2	26473818	missense	possibly damaging	0.64
R0025:Notch1	UTSW	2	26470931	missense	probably damaging	1.00
R0129:Notch1	UTSW	2	26460458	missense	probably benign	0.06
R0285:Notch1	UTSW	2	26460861	missense	possibly damaging	0.88
R0531:Notch1	UTSW	2	26466572	missense	probably benign	0.00
R0747:Notch1	UTSW	2	26472140	missense	unknown
R1440:Notch1	UTSW	2	26480964	intron	probably benign
R1502:Notch1	UTSW	2	26484323	missense	possibly damaging	0.95
R1539:Notch1	UTSW	2	26472113	nonsense	probably null
R1623:Notch1	UTSW	2	26478612	missense	possibly damaging	0.88
R1844:Notch1	UTSW	2	26460434	missense	probably benign	0.12
R1863:Notch1	UTSW	2	26469950	missense	probably damaging	1.00
R1874:Notch1	UTSW	2	26481579	missense	possibly damaging	0.89
R1926:Notch1	UTSW	2	26481657	missense	probably damaging	1.00
R2156:Notch1	UTSW	2	26460861	missense	possibly damaging	0.91
R2196:Notch1	UTSW	2	26463804	nonsense	probably null
R2209:Notch1	UTSW	2	26460007	missense	probably benign
R2382:Notch1	UTSW	2	26473781	missense	probably benign	0.40
R2508:Notch1	UTSW	2	26465473	missense	possibly damaging	0.80
R2873:Notch1	UTSW	2	26460235	missense	possibly damaging	0.89
R2874:Notch1	UTSW	2	26460235	missense	possibly damaging	0.89
R3798:Notch1	UTSW	2	26478618	missense	probably benign	0.00
R4019:Notch1	UTSW	2	26481142	missense	probably benign	0.03
R4305:Notch1	UTSW	2	26477924	missense	probably damaging	1.00
R4334:Notch1	UTSW	2	26460036	missense	probably benign	0.22
R4504:Notch1	UTSW	2	26472177	missense	probably benign	0.16
R4624:Notch1	UTSW	2	26478081	missense	possibly damaging	0.94
R4659:Notch1	UTSW	2	26470889	missense	probably damaging	0.99
R4703:Notch1	UTSW	2	26471158	missense	probably benign
R4869:Notch1	UTSW	2	26471179	missense	probably benign	0.21
R4938:Notch1	UTSW	2	26474124	nonsense	probably null
R4989:Notch1	UTSW	2	26481181	missense	probably damaging	1.00
R5010:Notch1	UTSW	2	26476114	missense	possibly damaging	0.96
R5283:Notch1	UTSW	2	26468626	missense	probably damaging	1.00
R5303:Notch1	UTSW	2	26478619	missense	probably benign	0.01
R5635:Notch1	UTSW	2	26476161	missense	probably damaging	1.00
R5755:Notch1	UTSW	2	26473692	missense	probably benign	0.12
R5926:Notch1	UTSW	2	26476104	missense	probably benign	0.35
R5947:Notch1	UTSW	2	26462528	intron	probably benign
R6053:Notch1	UTSW	2	26472912	missense	probably benign	0.06
R6161:Notch1	UTSW	2	26468731	missense	probably damaging	1.00
R6162:Notch1	UTSW	2	26462195	missense	probably benign
R6174:Notch1	UTSW	2	26485442	missense	possibly damaging	0.50
R6199:Notch1	UTSW	2	26469899	missense	probably damaging	0.98
R6209:Notch1	UTSW	2	26472805	missense	probably damaging	1.00
R6251:Notch1	UTSW	2	26474170	missense	possibly damaging	0.64
R6723:Notch1	UTSW	2	26478106	missense	probably damaging	1.00
R6736:Notch1	UTSW	2	26460286	missense	probably benign	0.01
R7020:Notch1	UTSW	2	26481574	missense	possibly damaging	0.95
R7058:Notch1	UTSW	2	26463818	missense	probably benign	0.05
R7154:Notch1	UTSW	2	26459938	missense	probably benign
R7291:Notch1	UTSW	2	26476375	missense	probably benign	0.01
R7379:Notch1	UTSW	2	26479467	missense	probably damaging	1.00
R7560:Notch1	UTSW	2	26460165	missense	probably benign	0.43
R7610:Notch1	UTSW	2	26478179	missense	probably benign	0.13
R7833:Notch1	UTSW	2	26459533	makesense	probably null
R7988:Notch1	UTSW	2	26471001	missense	probably benign	0.00
R8493:Notch1	UTSW	2	26472239	missense	unknown
R8514:Notch1	UTSW	2	26472169	missense	probably damaging	1.00
R8523:Notch1	UTSW	2	26464905	missense	possibly damaging	0.82
R8677:Notch1	UTSW	2	26469924	missense	probably damaging	1.00
R8696:Notch1	UTSW	2	26477992	critical splice acceptor site	probably benign
R8833:Notch1	UTSW	2	26481603	missense	probably damaging	1.00
R8964:Notch1	UTSW	2	26481050	missense	possibly damaging	0.65
R9091:Notch1	UTSW	2	26479883	missense	probably damaging	0.99
R9144:Notch1	UTSW	2	26459575	missense	probably benign	0.00
R9145:Notch1	UTSW	2	26459575	missense	probably benign	0.00
R9151:Notch1	UTSW	2	26477927	missense	probably benign	0.01
R9270:Notch1	UTSW	2	26479883	missense	probably damaging	0.99
X0018:Notch1	UTSW	2	26462227	nonsense	probably null
X0066:Notch1	UTSW	2	26470335	missense	possibly damaging	0.90
Z1088:Notch1	UTSW	2	26477115	missense	probably damaging	0.99
Z1177:Notch1	UTSW	2	26460309	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- GGTTCATTCTGGCTCATCAACC -3'
(R):5'- AGGACCTTAGGGAACTCCTCAC -3'

Sequencing Primer
(F):5'- CAATGATGACACCAGGGAGCC -3'
(R):5'- GACCTTAGGGAACTCCTCACTCTTC -3'

Posted On

2018-06-06