Incidental Mutation 'R6490:Zfp623'
ID 522810
Institutional Source Beutler Lab
Gene Symbol Zfp623
Ensembl Gene ENSMUSG00000050846
Gene Name zinc finger protein 623
Synonyms 2610029D06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.446) question?
Stock # R6490 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 75940952-75949400 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 75948459 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 421 (H421Q)
Ref Sequence ENSEMBL: ENSMUSP00000036049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037260]
AlphaFold Q9CY99
Predicted Effect probably damaging
Transcript: ENSMUST00000037260
AA Change: H421Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036049
Gene: ENSMUSG00000050846
AA Change: H421Q

DomainStartEndE-ValueType
ZnF_C2H2 119 141 5.59e-4 SMART
ZnF_C2H2 147 169 9.96e-1 SMART
ZnF_C2H2 175 197 2.4e-3 SMART
ZnF_C2H2 203 225 6.42e-4 SMART
ZnF_C2H2 231 253 1.3e-4 SMART
ZnF_C2H2 259 281 1.3e-4 SMART
ZnF_C2H2 287 309 1.28e-3 SMART
ZnF_C2H2 315 337 3.21e-4 SMART
ZnF_C2H2 343 365 3.39e-3 SMART
ZnF_C2H2 371 393 4.87e-4 SMART
ZnF_C2H2 399 421 2.53e-2 SMART
ZnF_C2H2 427 449 3.95e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik T G 8: 121,540,554 K38T probably benign Het
4932415D10Rik A T 10: 82,289,304 L2624Q possibly damaging Het
Abca13 A G 11: 9,298,661 T2803A probably benign Het
Adam23 A G 1: 63,557,454 D565G probably damaging Het
Adcy3 A G 12: 4,212,150 T1067A probably damaging Het
Agrn A T 4: 156,167,362 Y1921* probably null Het
Apc2 A G 10: 80,313,923 N1604D probably benign Het
Atxn7 A T 14: 14,089,446 R321* probably null Het
Axin1 T A 17: 26,142,994 I104N probably damaging Het
Bahd1 T C 2: 118,917,138 S413P probably benign Het
Baz2b C T 2: 59,901,729 C2024Y probably damaging Het
Cacna1i T A 15: 80,378,247 V1388E probably damaging Het
Ccdc129 A G 6: 55,976,420 D907G probably damaging Het
Ces4a G A 8: 105,149,458 V544M probably benign Het
Cntn3 G A 6: 102,278,340 T199I probably damaging Het
Col6a4 A T 9: 106,074,992 L569* probably null Het
Ctnna2 A G 6: 77,143,909 I12T probably benign Het
Dhx37 A G 5: 125,419,132 M754T probably benign Het
Dmrt1 T A 19: 25,546,031 S249T possibly damaging Het
Ell G T 8: 70,572,903 S59I probably damaging Het
Fam89a G A 8: 124,741,243 S110F probably damaging Het
Fer1l4 A C 2: 156,047,914 F278V possibly damaging Het
Fyn T C 10: 39,551,402 I427T probably damaging Het
Galnt14 T C 17: 73,525,370 D250G probably damaging Het
Glp1r T C 17: 30,924,572 V194A probably damaging Het
Glt1d1 T A 5: 127,644,296 probably null Het
Gm7995 A G 14: 42,311,370 K69R probably benign Het
Grip1 A G 10: 119,986,424 T379A possibly damaging Het
Gtpbp2 G T 17: 46,168,221 A570S probably benign Het
Hmcn1 T C 1: 150,583,278 I5192V probably benign Het
Igfl3 A T 7: 18,179,919 I65F possibly damaging Het
Igsf10 G T 3: 59,329,571 T1063K probably benign Het
Itfg1 A G 8: 85,740,301 V381A probably benign Het
Jmjd8 T A 17: 25,829,112 V16E probably benign Het
Kank1 A G 19: 25,410,085 Y374C probably damaging Het
Kcnma1 C T 14: 23,336,097 V891I possibly damaging Het
Kif20a C A 18: 34,629,490 T472K possibly damaging Het
Klhl32 A T 4: 24,711,578 probably benign Het
Lrrc37a A G 11: 103,456,660 S3070P unknown Het
Mettl21e T G 1: 44,210,265 Y77S probably damaging Het
Mlst8 G T 17: 24,477,961 D82E probably benign Het
Mrgprx2 A T 7: 48,482,869 L67Q probably damaging Het
Mylk T A 16: 34,929,867 L1192Q possibly damaging Het
Myt1l A T 12: 29,832,366 Y520F unknown Het
Naip2 A T 13: 100,160,685 W948R probably benign Het
Nlrp9a A C 7: 26,550,886 K25N probably damaging Het
Nsd3 T C 8: 25,714,185 C414R probably damaging Het
Oit3 A T 10: 59,438,552 V142D possibly damaging Het
Olfr171 C T 16: 19,624,444 V219M probably benign Het
P2ry6 T C 7: 100,938,373 T260A probably damaging Het
Papola A G 12: 105,804,937 Q87R probably benign Het
Pla2g4a T A 1: 149,851,335 R557* probably null Het
Rgs13 G T 1: 144,140,838 H56N probably damaging Het
Sbf1 T C 15: 89,304,908 S537G probably benign Het
Sntg1 A C 1: 8,583,284 L243R possibly damaging Het
Stam2 T C 2: 52,720,942 T23A probably benign Het
Tbl1xr1 C A 3: 22,203,977 H467Q probably damaging Het
Tmem131l A G 3: 83,913,280 S1222P possibly damaging Het
Tmem43 G T 6: 91,478,777 Q123H probably damaging Het
Tmem43 T A 6: 91,486,880 I379N possibly damaging Het
Trim43c A T 9: 88,844,950 I277F possibly damaging Het
Ttn A G 2: 76,872,867 probably benign Het
Vmn1r75 T A 7: 11,881,076 V245D probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vps53 A T 11: 76,077,055 M414K probably benign Het
Wrn T G 8: 33,319,220 L249F probably benign Het
Zc3h13 TGATGTCCGGGATGTCCGGGATGTCCGGGATGTCCGGGATGT TGATGTCCGGGATGTCCGGGATGTCCGGGATGT 14: 75,323,558 probably benign Het
Zfp454 T C 11: 50,874,123 N161D probably benign Het
Zfp619 G A 7: 39,534,162 G60R probably benign Het
Zfp827 A G 8: 79,189,977 probably benign Het
Other mutations in Zfp623
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Zfp623 APN 15 75948203 missense probably damaging 1.00
IGL01524:Zfp623 APN 15 75947679 missense probably benign
IGL01927:Zfp623 APN 15 75947505 missense possibly damaging 0.57
IGL03199:Zfp623 APN 15 75947270 missense probably benign 0.40
R0076:Zfp623 UTSW 15 75947209 missense probably benign
R0352:Zfp623 UTSW 15 75948584 missense probably benign 0.00
R0360:Zfp623 UTSW 15 75948661 missense probably benign
R0364:Zfp623 UTSW 15 75948661 missense probably benign
R1783:Zfp623 UTSW 15 75947911 missense probably damaging 0.99
R2219:Zfp623 UTSW 15 75947530 missense possibly damaging 0.90
R5975:Zfp623 UTSW 15 75948163 missense probably benign 0.43
R6161:Zfp623 UTSW 15 75948621 missense probably benign 0.22
R6342:Zfp623 UTSW 15 75947988 nonsense probably null
R6513:Zfp623 UTSW 15 75947468 missense probably benign
R7028:Zfp623 UTSW 15 75948305 missense probably damaging 0.99
R7399:Zfp623 UTSW 15 75947398 missense probably damaging 0.98
R7716:Zfp623 UTSW 15 75948422 missense probably damaging 1.00
R8362:Zfp623 UTSW 15 75947639 missense probably damaging 1.00
R8445:Zfp623 UTSW 15 75947553 nonsense probably null
R9028:Zfp623 UTSW 15 75947500 missense probably damaging 0.97
R9035:Zfp623 UTSW 15 75948313 missense possibly damaging 0.93
R9310:Zfp623 UTSW 15 75948100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAAGATCCACACTGGTG -3'
(R):5'- ACACTCCCGATCTGTAGACCTC -3'

Sequencing Primer
(F):5'- ACACTGGTGAACGGGTGTATG -3'
(R):5'- TCTCTCCTAAATGAACGGAGGTC -3'
Posted On 2018-06-06