Incidental Mutation 'R6493:Olfml3'
ID522815
Institutional Source Beutler Lab
Gene Symbol Olfml3
Ensembl Gene ENSMUSG00000027848
Gene Nameolfactomedin-like 3
Synonyms2810002E22Rik, HNOEL-iso, mONT3, ONT3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6493 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location103722222-103738001 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103736207 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 286 (V286D)
Ref Sequence ENSEMBL: ENSMUSP00000029440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029440] [ENSMUST00000106852] [ENSMUST00000118317] [ENSMUST00000169286]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029440
AA Change: V286D

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029440
Gene: ENSMUSG00000027848
AA Change: V286D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
Blast:OLF 65 133 8e-34 BLAST
OLF 137 401 9.22e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106852
Predicted Effect probably benign
Transcript: ENSMUST00000118317
SMART Domains Protein: ENSMUSP00000113998
Gene: ENSMUSG00000008730

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 941 959 N/A INTRINSIC
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1095 1111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157042
Predicted Effect probably benign
Transcript: ENSMUST00000169286
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the olfactomedin-like gene family which also includes genes encoding noelin, tiarin, myocilin, amassin, optimedin, photomedin, and latrophilin. The encoded protein is a secreted extracellular matrix glycoprotein with a C-terminal olfactomedin domain that facilitates protein-protein interactions, cell adhesion, and intercellular interactions. It serves as both a scaffold protein that recruits bone morphogenetic protein 1 to its substrate chordin, and as a vascular tissue remodeler with pro-angiogenic properties. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a disruption in this gene appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,293,878 H934L probably benign Het
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Ampd3 A G 7: 110,795,811 probably null Het
Axdnd1 A T 1: 156,380,813 I485N probably damaging Het
Bscl2 A G 19: 8,839,774 D22G probably damaging Het
Ccdc96 A G 5: 36,486,252 E534G probably damaging Het
Cdc42bpg G T 19: 6,318,455 G1061V probably damaging Het
Cers3 T C 7: 66,743,720 Y26H probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Daxx T A 17: 33,912,371 probably null Het
Egf T C 3: 129,719,088 probably benign Het
Eps15 A G 4: 109,368,948 D629G probably damaging Het
Fancm G A 12: 65,097,488 A575T probably benign Het
Fat4 G A 3: 38,890,887 D1310N probably damaging Het
Gm10424 A G 5: 95,270,825 L104P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Grxcr2 G A 18: 41,998,701 P101L possibly damaging Het
Hsd17b12 A T 2: 94,043,883 I225N probably damaging Het
Kcnj8 T C 6: 142,566,047 Y278C probably damaging Het
Lama3 G A 18: 12,482,148 probably null Het
Lax1 C T 1: 133,679,792 D404N probably benign Het
Lipg T C 18: 74,948,024 K329E probably damaging Het
Lysmd2 T G 9: 75,635,702 L197R probably damaging Het
Maneal A T 4: 124,857,171 I264N probably damaging Het
Myh4 A G 11: 67,258,629 N1729S probably benign Het
Myl2 A G 5: 122,106,728 N154D possibly damaging Het
Nlrp9c T A 7: 26,382,387 D638V probably damaging Het
Notch1 T C 2: 26,472,098 H74R unknown Het
Olfr1271 G A 2: 90,265,708 H241Y probably damaging Het
Olfr228 T C 2: 86,483,221 I174V possibly damaging Het
Olfr310 T G 7: 86,268,882 K302N probably benign Het
Olfr559 G T 7: 102,724,080 R137S possibly damaging Het
Olfr562-ps1 A G 7: 102,782,396 K307E probably benign Het
Parn A C 16: 13,656,925 F127V probably damaging Het
Pcdhac2 T C 18: 37,144,705 V246A probably damaging Het
Plin2 G A 4: 86,661,987 T90I possibly damaging Het
Podxl C T 6: 31,525,046 C326Y probably damaging Het
Prl8a8 T A 13: 27,507,352 K223* probably null Het
Ptprh T G 7: 4,580,990 E201A possibly damaging Het
Rtn1 A C 12: 72,308,329 V281G probably damaging Het
Scaf8 T C 17: 3,171,119 S294P unknown Het
Shroom3 C A 5: 92,941,561 N723K probably benign Het
Spata22 T C 11: 73,353,746 *312R probably null Het
Stx7 T C 10: 24,185,071 probably null Het
Taar6 T C 10: 23,985,123 D175G probably benign Het
Tbccd1 A C 16: 22,822,466 L387R probably damaging Het
Tecpr1 T C 5: 144,209,974 M525V probably benign Het
Tex10 A T 4: 48,436,450 I756N probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn T C 2: 76,741,997 E24438G probably damaging Het
Wdpcp C T 11: 21,711,631 T301I possibly damaging Het
Zbtb1 C T 12: 76,386,473 T411I probably benign Het
Zcchc11 A G 4: 108,526,805 K1053R probably damaging Het
Zzef1 G A 11: 72,913,303 G2624R probably benign Het
Other mutations in Olfml3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Olfml3 APN 3 103736982 unclassified probably null
IGL02130:Olfml3 APN 3 103736967 missense probably benign 0.20
R0133:Olfml3 UTSW 3 103737026 unclassified probably null
R0427:Olfml3 UTSW 3 103737014 missense probably benign 0.27
R2130:Olfml3 UTSW 3 103735869 missense probably benign 0.05
R2131:Olfml3 UTSW 3 103735869 missense probably benign 0.05
R2133:Olfml3 UTSW 3 103735869 missense probably benign 0.05
R4688:Olfml3 UTSW 3 103732181 utr 3 prime probably benign
R5211:Olfml3 UTSW 3 103737199 missense probably benign
R5227:Olfml3 UTSW 3 103736421 missense possibly damaging 0.86
R6223:Olfml3 UTSW 3 103736460 missense probably damaging 1.00
R7128:Olfml3 UTSW 3 103737168 missense probably benign
R7191:Olfml3 UTSW 3 103735860 missense probably damaging 0.99
R7224:Olfml3 UTSW 3 103735860 missense probably damaging 0.99
R7298:Olfml3 UTSW 3 103735860 missense probably damaging 0.99
R7299:Olfml3 UTSW 3 103735860 missense probably damaging 0.99
R7300:Olfml3 UTSW 3 103735860 missense probably damaging 0.99
R7355:Olfml3 UTSW 3 103736079 missense probably damaging 1.00
X0058:Olfml3 UTSW 3 103732116 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- ACCACTGGCATCGAAGGAAC -3'
(R):5'- ATTATGCTCGAAGGCCTCCTG -3'

Sequencing Primer
(F):5'- CTGAATACGAGCCCTACTGG -3'
(R):5'- CTGGAGGACCTGGAGGG -3'
Posted On2018-06-06