Incidental Mutation 'R6490:Mylk'
ID 522818
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Name myosin, light polypeptide kinase
Synonyms Mlck, nmMlck, telokin, A930019C19Rik, 9530072E15Rik, MLCK108, MLCK210
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6490 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 34745210-35002420 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34929867 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 1192 (L1192Q)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000023538
AA Change: L1192Q

PolyPhen 2 Score 0.743 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: L1192Q

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232482
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik T G 8: 121,540,554 K38T probably benign Het
4932415D10Rik A T 10: 82,289,304 L2624Q possibly damaging Het
Abca13 A G 11: 9,298,661 T2803A probably benign Het
Adam23 A G 1: 63,557,454 D565G probably damaging Het
Adcy3 A G 12: 4,212,150 T1067A probably damaging Het
Agrn A T 4: 156,167,362 Y1921* probably null Het
Apc2 A G 10: 80,313,923 N1604D probably benign Het
Atxn7 A T 14: 14,089,446 R321* probably null Het
Axin1 T A 17: 26,142,994 I104N probably damaging Het
Bahd1 T C 2: 118,917,138 S413P probably benign Het
Baz2b C T 2: 59,901,729 C2024Y probably damaging Het
Cacna1i T A 15: 80,378,247 V1388E probably damaging Het
Ccdc129 A G 6: 55,976,420 D907G probably damaging Het
Ces4a G A 8: 105,149,458 V544M probably benign Het
Cntn3 G A 6: 102,278,340 T199I probably damaging Het
Col6a4 A T 9: 106,074,992 L569* probably null Het
Ctnna2 A G 6: 77,143,909 I12T probably benign Het
Dhx37 A G 5: 125,419,132 M754T probably benign Het
Dmrt1 T A 19: 25,546,031 S249T possibly damaging Het
Ell G T 8: 70,572,903 S59I probably damaging Het
Fam89a G A 8: 124,741,243 S110F probably damaging Het
Fer1l4 A C 2: 156,047,914 F278V possibly damaging Het
Fyn T C 10: 39,551,402 I427T probably damaging Het
Galnt14 T C 17: 73,525,370 D250G probably damaging Het
Glp1r T C 17: 30,924,572 V194A probably damaging Het
Glt1d1 T A 5: 127,644,296 probably null Het
Gm7995 A G 14: 42,311,370 K69R probably benign Het
Grip1 A G 10: 119,986,424 T379A possibly damaging Het
Gtpbp2 G T 17: 46,168,221 A570S probably benign Het
Hmcn1 T C 1: 150,583,278 I5192V probably benign Het
Igfl3 A T 7: 18,179,919 I65F possibly damaging Het
Igsf10 G T 3: 59,329,571 T1063K probably benign Het
Itfg1 A G 8: 85,740,301 V381A probably benign Het
Jmjd8 T A 17: 25,829,112 V16E probably benign Het
Kank1 A G 19: 25,410,085 Y374C probably damaging Het
Kcnma1 C T 14: 23,336,097 V891I possibly damaging Het
Kif20a C A 18: 34,629,490 T472K possibly damaging Het
Klhl32 A T 4: 24,711,578 probably benign Het
Lrrc37a A G 11: 103,456,660 S3070P unknown Het
Mettl21e T G 1: 44,210,265 Y77S probably damaging Het
Mlst8 G T 17: 24,477,961 D82E probably benign Het
Mrgprx2 A T 7: 48,482,869 L67Q probably damaging Het
Myt1l A T 12: 29,832,366 Y520F unknown Het
Naip2 A T 13: 100,160,685 W948R probably benign Het
Nlrp9a A C 7: 26,550,886 K25N probably damaging Het
Nsd3 T C 8: 25,714,185 C414R probably damaging Het
Oit3 A T 10: 59,438,552 V142D possibly damaging Het
Olfr171 C T 16: 19,624,444 V219M probably benign Het
P2ry6 T C 7: 100,938,373 T260A probably damaging Het
Papola A G 12: 105,804,937 Q87R probably benign Het
Pla2g4a T A 1: 149,851,335 R557* probably null Het
Rgs13 G T 1: 144,140,838 H56N probably damaging Het
Sbf1 T C 15: 89,304,908 S537G probably benign Het
Sntg1 A C 1: 8,583,284 L243R possibly damaging Het
Stam2 T C 2: 52,720,942 T23A probably benign Het
Tbl1xr1 C A 3: 22,203,977 H467Q probably damaging Het
Tmem131l A G 3: 83,913,280 S1222P possibly damaging Het
Tmem43 G T 6: 91,478,777 Q123H probably damaging Het
Tmem43 T A 6: 91,486,880 I379N possibly damaging Het
Trim43c A T 9: 88,844,950 I277F possibly damaging Het
Ttn A G 2: 76,872,867 probably benign Het
Vmn1r75 T A 7: 11,881,076 V245D probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vps53 A T 11: 76,077,055 M414K probably benign Het
Wrn T G 8: 33,319,220 L249F probably benign Het
Zc3h13 TGATGTCCGGGATGTCCGGGATGTCCGGGATGTCCGGGATGT TGATGTCCGGGATGTCCGGGATGTCCGGGATGT 14: 75,323,558 probably benign Het
Zfp454 T C 11: 50,874,123 N161D probably benign Het
Zfp619 G A 7: 39,534,162 G60R probably benign Het
Zfp623 T A 15: 75,948,459 H421Q probably damaging Het
Zfp827 A G 8: 79,189,977 probably benign Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34938952 missense probably benign 0.36
IGL01386:Mylk APN 16 34971240 critical splice acceptor site probably null
IGL01684:Mylk APN 16 34971940 missense possibly damaging 0.55
IGL01884:Mylk APN 16 34988877 splice site probably benign
IGL02079:Mylk APN 16 34860631 missense possibly damaging 0.87
IGL02104:Mylk APN 16 34815435 missense probably benign 0.06
IGL02624:Mylk APN 16 34929896 missense probably benign 0.29
IGL02756:Mylk APN 16 34963646 missense probably benign 0.42
IGL02794:Mylk APN 16 34986541 missense probably benign 0.21
IGL02833:Mylk APN 16 34914900 missense probably benign 0.01
IGL02946:Mylk APN 16 34921788 missense probably benign 0.10
IGL03012:Mylk APN 16 34952781 missense probably benign 0.03
IGL03093:Mylk APN 16 34912192 missense possibly damaging 0.62
IGL03272:Mylk APN 16 34979189 missense probably benign 0.09
billy UTSW 16 34875620 missense probably damaging 0.97
brutus UTSW 16 34953695 missense probably benign 0.12
Club UTSW 16 34912275 nonsense probably null
popeye UTSW 16 34963577 missense probably benign 0.29
F5770:Mylk UTSW 16 34995204 critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34977113 splice site probably benign
PIT4382001:Mylk UTSW 16 34875642 missense probably damaging 0.99
R0131:Mylk UTSW 16 34875504 missense probably benign 0.03
R0309:Mylk UTSW 16 34912297 splice site probably benign
R0358:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0381:Mylk UTSW 16 34784974 splice site probably null
R0390:Mylk UTSW 16 34875620 missense probably damaging 0.97
R0413:Mylk UTSW 16 34921944 missense probably benign 0.01
R0536:Mylk UTSW 16 35000387 missense possibly damaging 0.95
R0544:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0545:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0546:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0547:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0548:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0627:Mylk UTSW 16 35000429 missense probably damaging 1.00
R0726:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0755:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0782:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0783:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0784:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1136:Mylk UTSW 16 35000318 missense probably damaging 1.00
R1170:Mylk UTSW 16 34874039 missense probably benign 0.20
R1222:Mylk UTSW 16 34860652 missense probably benign 0.12
R1445:Mylk UTSW 16 34815465 missense possibly damaging 0.57
R1583:Mylk UTSW 16 34875586 missense probably benign 0.29
R1618:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1643:Mylk UTSW 16 34875635 missense probably benign 0.03
R1702:Mylk UTSW 16 34921944 missense probably benign 0.00
R1776:Mylk UTSW 16 34952782 missense probably benign 0.16
R1865:Mylk UTSW 16 34912230 missense probably benign 0.03
R1975:Mylk UTSW 16 34880303 splice site probably null
R2016:Mylk UTSW 16 34996817 missense probably damaging 1.00
R2045:Mylk UTSW 16 34953653 missense probably benign 0.29
R2134:Mylk UTSW 16 34986476 missense probably benign 0.13
R3547:Mylk UTSW 16 34880168 missense possibly damaging 0.61
R3844:Mylk UTSW 16 34921877 missense probably benign 0.01
R4003:Mylk UTSW 16 34963577 missense probably benign 0.29
R4396:Mylk UTSW 16 34912275 nonsense probably null
R4470:Mylk UTSW 16 34912152 missense probably benign 0.09
R4507:Mylk UTSW 16 34953695 missense probably benign 0.12
R4700:Mylk UTSW 16 34922435 missense probably benign 0.16
R4751:Mylk UTSW 16 34879169 missense probably benign 0.29
R4815:Mylk UTSW 16 34894925 missense probably damaging 0.97
R4832:Mylk UTSW 16 34922367 missense probably benign 0.36
R4872:Mylk UTSW 16 34914990 missense possibly damaging 0.89
R4953:Mylk UTSW 16 34988961 missense probably damaging 1.00
R4969:Mylk UTSW 16 34971440 missense probably damaging 0.96
R5009:Mylk UTSW 16 34899507 missense probably benign 0.39
R5130:Mylk UTSW 16 34988997 missense probably damaging 1.00
R5173:Mylk UTSW 16 34977013 missense probably benign 0.40
R5195:Mylk UTSW 16 34979215 missense probably damaging 1.00
R5209:Mylk UTSW 16 34922625 missense possibly damaging 0.55
R5311:Mylk UTSW 16 34921757 missense probably benign 0.01
R5418:Mylk UTSW 16 34912230 missense probably benign 0.02
R5481:Mylk UTSW 16 34921604 missense probably benign 0.09
R5590:Mylk UTSW 16 34879352 missense probably benign 0.29
R5603:Mylk UTSW 16 34956492 missense probably benign 0.06
R5823:Mylk UTSW 16 34894947 critical splice donor site probably null
R6290:Mylk UTSW 16 34894843 missense probably benign 0.39
R6351:Mylk UTSW 16 34921971 missense probably benign 0.01
R6365:Mylk UTSW 16 34860591 missense probably benign 0.12
R6723:Mylk UTSW 16 34929888 missense possibly damaging 0.74
R6864:Mylk UTSW 16 34874150 missense probably benign 0.03
R6908:Mylk UTSW 16 34880273 missense probably benign 0.18
R6949:Mylk UTSW 16 35000318 missense probably damaging 1.00
R7018:Mylk UTSW 16 35000426 missense possibly damaging 0.88
R7035:Mylk UTSW 16 34976982 missense possibly damaging 0.89
R7162:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7236:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7269:Mylk UTSW 16 34785011 missense probably damaging 0.96
R7475:Mylk UTSW 16 34914076 splice site probably null
R7525:Mylk UTSW 16 34988987 missense probably benign 0.06
R7587:Mylk UTSW 16 34922517 missense probably benign 0.29
R7607:Mylk UTSW 16 34894814 missense probably benign 0.09
R7616:Mylk UTSW 16 34879557 missense probably damaging 0.97
R7647:Mylk UTSW 16 34879524 missense probably benign 0.29
R7648:Mylk UTSW 16 34879524 missense probably benign 0.29
R7764:Mylk UTSW 16 34922183 missense probably benign 0.16
R7890:Mylk UTSW 16 34963648 nonsense probably null
R7892:Mylk UTSW 16 34879524 missense probably benign 0.29
R7893:Mylk UTSW 16 34879524 missense probably benign 0.29
R8065:Mylk UTSW 16 34972019 missense probably benign 0.08
R8067:Mylk UTSW 16 34972019 missense probably benign 0.08
R8143:Mylk UTSW 16 34914155 missense possibly damaging 0.87
R8210:Mylk UTSW 16 35000351 missense probably damaging 1.00
R8271:Mylk UTSW 16 34922579 missense probably damaging 0.97
R8540:Mylk UTSW 16 34929887 missense possibly damaging 0.87
R8721:Mylk UTSW 16 34996806 missense probably damaging 1.00
R8743:Mylk UTSW 16 34921057 missense probably benign 0.03
R8798:Mylk UTSW 16 34899402 missense possibly damaging 0.89
R8956:Mylk UTSW 16 34971409 missense probably benign 0.01
R9131:Mylk UTSW 16 34956465 missense probably benign 0.29
R9403:Mylk UTSW 16 34875642 nonsense probably null
R9624:Mylk UTSW 16 34879307 missense probably benign 0.29
R9735:Mylk UTSW 16 34914809 missense probably benign 0.09
R9756:Mylk UTSW 16 34914017 missense probably damaging 0.96
R9763:Mylk UTSW 16 34879112 nonsense probably null
RF001:Mylk UTSW 16 34879371 missense probably benign 0.03
V7580:Mylk UTSW 16 34995204 critical splice donor site probably null
V7583:Mylk UTSW 16 34995204 critical splice donor site probably null
X0065:Mylk UTSW 16 35000441 missense probably damaging 1.00
Z1177:Mylk UTSW 16 34922651 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- CGTCAACAGAGAGTTTGCAGG -3'
(R):5'- AATCAAGGTGAGGCCACTTG -3'

Sequencing Primer
(F):5'- TCAACAGAGAGTTTGCAGGAGTCAG -3'
(R):5'- TGATTCTCACCAAATGAATGCTG -3'
Posted On 2018-06-06