Incidental Mutation 'R6493:Tecpr1'
ID 522840
Institutional Source Beutler Lab
Gene Symbol Tecpr1
Ensembl Gene ENSMUSG00000066621
Gene Name tectonin beta-propeller repeat containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6493 (G1)
Quality Score 199.009
Status Not validated
Chromosome 5
Chromosomal Location 144194442-144223615 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144209974 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 525 (M525V)
Ref Sequence ENSEMBL: ENSMUSP00000082844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085701]
AlphaFold Q80VP0
Predicted Effect probably benign
Transcript: ENSMUST00000085701
AA Change: M525V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: M525V

DomainStartEndE-ValueType
TECPR 23 59 8.98e1 SMART
DysFN 64 125 6.72e-24 SMART
DysFC 137 170 1.89e-9 SMART
TECPR 192 225 1.79e-1 SMART
TECPR 234 270 2.5e-9 SMART
TECPR 279 317 4.99e-9 SMART
TECPR 326 361 2.42e-7 SMART
low complexity region 381 394 N/A INTRINSIC
PH 614 724 1.69e-2 SMART
TECPR 711 750 1.88e-4 SMART
TECPR 766 800 3.27e-4 SMART
DysFN 821 882 2.95e-20 SMART
DysFC 893 926 1.66e-14 SMART
TECPR 940 974 1.69e1 SMART
TECPR 983 1019 1.45e-5 SMART
TECPR 1028 1065 1.51e-8 SMART
TECPR 1074 1109 1.59e-2 SMART
low complexity region 1125 1137 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156129
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,293,878 H934L probably benign Het
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Ampd3 A G 7: 110,795,811 probably null Het
Axdnd1 A T 1: 156,380,813 I485N probably damaging Het
Bscl2 A G 19: 8,839,774 D22G probably damaging Het
Ccdc96 A G 5: 36,486,252 E534G probably damaging Het
Cdc42bpg G T 19: 6,318,455 G1061V probably damaging Het
Cers3 T C 7: 66,743,720 Y26H probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Daxx T A 17: 33,912,371 probably null Het
Egf T C 3: 129,719,088 probably benign Het
Eps15 A G 4: 109,368,948 D629G probably damaging Het
Fancm G A 12: 65,097,488 A575T probably benign Het
Fat4 G A 3: 38,890,887 D1310N probably damaging Het
Gm10424 A G 5: 95,270,825 L104P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Grxcr2 G A 18: 41,998,701 P101L possibly damaging Het
Hsd17b12 A T 2: 94,043,883 I225N probably damaging Het
Kcnj8 T C 6: 142,566,047 Y278C probably damaging Het
Lama3 G A 18: 12,482,148 probably null Het
Lax1 C T 1: 133,679,792 D404N probably benign Het
Lipg T C 18: 74,948,024 K329E probably damaging Het
Lysmd2 T G 9: 75,635,702 L197R probably damaging Het
Maneal A T 4: 124,857,171 I264N probably damaging Het
Myh4 A G 11: 67,258,629 N1729S probably benign Het
Myl2 A G 5: 122,106,728 N154D possibly damaging Het
Nlrp9c T A 7: 26,382,387 D638V probably damaging Het
Notch1 T C 2: 26,472,098 H74R unknown Het
Olfml3 A T 3: 103,736,207 V286D possibly damaging Het
Olfr1271 G A 2: 90,265,708 H241Y probably damaging Het
Olfr228 T C 2: 86,483,221 I174V possibly damaging Het
Olfr310 T G 7: 86,268,882 K302N probably benign Het
Olfr559 G T 7: 102,724,080 R137S possibly damaging Het
Olfr562-ps1 A G 7: 102,782,396 K307E probably benign Het
Parn A C 16: 13,656,925 F127V probably damaging Het
Pcdhac2 T C 18: 37,144,705 V246A probably damaging Het
Plin2 G A 4: 86,661,987 T90I possibly damaging Het
Podxl C T 6: 31,525,046 C326Y probably damaging Het
Prl8a8 T A 13: 27,507,352 K223* probably null Het
Ptprh T G 7: 4,580,990 E201A possibly damaging Het
Rtn1 A C 12: 72,308,329 V281G probably damaging Het
Scaf8 T C 17: 3,171,119 S294P unknown Het
Shroom3 C A 5: 92,941,561 N723K probably benign Het
Spata22 T C 11: 73,353,746 *312R probably null Het
Stx7 T C 10: 24,185,071 probably null Het
Taar6 T C 10: 23,985,123 D175G probably benign Het
Tbccd1 A C 16: 22,822,466 L387R probably damaging Het
Tex10 A T 4: 48,436,450 I756N probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn T C 2: 76,741,997 E24438G probably damaging Het
Wdpcp C T 11: 21,711,631 T301I possibly damaging Het
Zbtb1 C T 12: 76,386,473 T411I probably benign Het
Zcchc11 A G 4: 108,526,805 K1053R probably damaging Het
Zzef1 G A 11: 72,913,303 G2624R probably benign Het
Other mutations in Tecpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Tecpr1 APN 5 144208593 critical splice donor site probably null
IGL01774:Tecpr1 APN 5 144211540 missense probably damaging 0.97
IGL01960:Tecpr1 APN 5 144216919 missense probably benign 0.00
IGL01973:Tecpr1 APN 5 144197988 splice site probably benign
IGL02244:Tecpr1 APN 5 144210003 missense probably benign
IGL02247:Tecpr1 APN 5 144206554 missense possibly damaging 0.64
IGL02423:Tecpr1 APN 5 144203487 missense possibly damaging 0.88
IGL02679:Tecpr1 APN 5 144206546 missense probably benign 0.28
larghissimo UTSW 5 144217257 missense probably damaging 1.00
PIT4531001:Tecpr1 UTSW 5 144214067 missense probably damaging 0.96
R0121:Tecpr1 UTSW 5 144210199 missense probably benign 0.02
R0125:Tecpr1 UTSW 5 144197899 missense probably damaging 1.00
R0194:Tecpr1 UTSW 5 144218517 missense probably damaging 1.00
R0376:Tecpr1 UTSW 5 144207476 missense possibly damaging 0.94
R0441:Tecpr1 UTSW 5 144195941 missense probably benign
R0504:Tecpr1 UTSW 5 144214081 missense probably damaging 0.99
R0538:Tecpr1 UTSW 5 144206274 missense probably damaging 0.99
R0586:Tecpr1 UTSW 5 144217401 missense probably damaging 1.00
R0607:Tecpr1 UTSW 5 144212590 missense probably damaging 1.00
R0608:Tecpr1 UTSW 5 144211499 missense probably damaging 1.00
R0656:Tecpr1 UTSW 5 144214053 splice site probably null
R0835:Tecpr1 UTSW 5 144212592 missense possibly damaging 0.81
R1080:Tecpr1 UTSW 5 144216929 missense probably damaging 1.00
R1394:Tecpr1 UTSW 5 144206539 missense possibly damaging 0.77
R1597:Tecpr1 UTSW 5 144214310 missense probably benign 0.00
R1663:Tecpr1 UTSW 5 144197944 missense probably benign 0.17
R1785:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1786:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1833:Tecpr1 UTSW 5 144208608 missense probably damaging 0.99
R1883:Tecpr1 UTSW 5 144206529 missense probably benign 0.03
R1988:Tecpr1 UTSW 5 144204697 missense possibly damaging 0.94
R2130:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2131:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2132:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2133:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2172:Tecpr1 UTSW 5 144196417 missense probably damaging 1.00
R2172:Tecpr1 UTSW 5 144211456 missense probably benign 0.10
R2290:Tecpr1 UTSW 5 144214063 missense probably damaging 0.99
R3691:Tecpr1 UTSW 5 144209979 missense probably benign 0.10
R4027:Tecpr1 UTSW 5 144206259 missense probably benign 0.41
R4587:Tecpr1 UTSW 5 144212590 missense probably damaging 0.96
R4684:Tecpr1 UTSW 5 144207437 missense probably benign 0.16
R4864:Tecpr1 UTSW 5 144214117 missense probably benign 0.00
R4932:Tecpr1 UTSW 5 144204658 missense probably damaging 0.97
R4955:Tecpr1 UTSW 5 144217257 missense probably damaging 1.00
R5043:Tecpr1 UTSW 5 144197854 splice site probably null
R5459:Tecpr1 UTSW 5 144207416 missense probably damaging 1.00
R5579:Tecpr1 UTSW 5 144214344 missense possibly damaging 0.55
R5677:Tecpr1 UTSW 5 144218633 nonsense probably null
R5679:Tecpr1 UTSW 5 144207423 missense possibly damaging 0.69
R5802:Tecpr1 UTSW 5 144206546 missense probably benign 0.28
R6000:Tecpr1 UTSW 5 144211421 missense probably benign 0.02
R6022:Tecpr1 UTSW 5 144199191 missense possibly damaging 0.95
R6114:Tecpr1 UTSW 5 144204640 missense possibly damaging 0.81
R6251:Tecpr1 UTSW 5 144198576 missense probably damaging 0.97
R6372:Tecpr1 UTSW 5 144216958 missense probably damaging 1.00
R7276:Tecpr1 UTSW 5 144217020 nonsense probably null
R7314:Tecpr1 UTSW 5 144217332 missense probably damaging 1.00
R7375:Tecpr1 UTSW 5 144208599 missense possibly damaging 0.68
R7632:Tecpr1 UTSW 5 144218726 missense probably benign 0.03
R7702:Tecpr1 UTSW 5 144203418 missense probably damaging 1.00
R8135:Tecpr1 UTSW 5 144198602 missense probably damaging 0.99
R8406:Tecpr1 UTSW 5 144200840 missense probably damaging 1.00
R8844:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8856:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8857:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8866:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8903:Tecpr1 UTSW 5 144214027 intron probably benign
R8926:Tecpr1 UTSW 5 144216962 missense probably damaging 1.00
R9218:Tecpr1 UTSW 5 144217231 missense possibly damaging 0.70
R9423:Tecpr1 UTSW 5 144218578 missense probably damaging 0.98
RF001:Tecpr1 UTSW 5 144217386 missense probably damaging 0.99
Z1176:Tecpr1 UTSW 5 144218591 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGGCCCAAGGTCTTAGTAAGGG -3'
(R):5'- AAAGGCTCCTGAGACCTCTC -3'

Sequencing Primer
(F):5'- GCATCACAGAGTCTTGAGGC -3'
(R):5'- GAGACCTCTCGTTCTGATGAATGC -3'
Posted On 2018-06-06