Incidental Mutation 'R6493:Ptprh'
ID522846
Institutional Source Beutler Lab
Gene Symbol Ptprh
Ensembl Gene ENSMUSG00000035429
Gene Nameprotein tyrosine phosphatase, receptor type, H
SynonymsSAP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6493 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4548612-4604041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 4580990 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 201 (E201A)
Ref Sequence ENSEMBL: ENSMUSP00000145543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049113] [ENSMUST00000166650] [ENSMUST00000206999]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049113
AA Change: E201A

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000042396
Gene: ENSMUSG00000035429
AA Change: E201A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FN3 67 145 2.42e-9 SMART
FN3 156 234 9.69e-9 SMART
FN3 245 323 1.57e-8 SMART
FN3 334 412 6.29e-8 SMART
FN3 427 505 7.75e-8 SMART
FN3 516 593 1.21e0 SMART
transmembrane domain 605 627 N/A INTRINSIC
PTPc 670 932 1.09e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000103950
Predicted Effect possibly damaging
Transcript: ENSMUST00000166650
AA Change: E201A

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125833
Gene: ENSMUSG00000035429
AA Change: E201A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FN3 67 145 2.42e-9 SMART
FN3 156 234 9.69e-9 SMART
FN3 245 323 1.57e-8 SMART
FN3 334 412 6.29e-8 SMART
FN3 427 505 7.75e-8 SMART
FN3 516 593 1.21e0 SMART
transmembrane domain 605 627 N/A INTRINSIC
PTPc 670 932 1.09e-132 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000206999
AA Change: E201A

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. The extracellular region contains eight fibronectin type III-like repeats and multiple N-glycosylation sites. The gene was shown to be expressed primarily in brain and liver, and at a lower level in heart and stomach. It was also found to be expressed in several cancer cell lines, but not in the corresponding normal tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null alllele exhibit normal intestinal epithelial cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,293,878 H934L probably benign Het
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Ampd3 A G 7: 110,795,811 probably null Het
Axdnd1 A T 1: 156,380,813 I485N probably damaging Het
Bscl2 A G 19: 8,839,774 D22G probably damaging Het
Ccdc96 A G 5: 36,486,252 E534G probably damaging Het
Cdc42bpg G T 19: 6,318,455 G1061V probably damaging Het
Cers3 T C 7: 66,743,720 Y26H probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Daxx T A 17: 33,912,371 probably null Het
Egf T C 3: 129,719,088 probably benign Het
Eps15 A G 4: 109,368,948 D629G probably damaging Het
Fancm G A 12: 65,097,488 A575T probably benign Het
Fat4 G A 3: 38,890,887 D1310N probably damaging Het
Gm10424 A G 5: 95,270,825 L104P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Grxcr2 G A 18: 41,998,701 P101L possibly damaging Het
Hsd17b12 A T 2: 94,043,883 I225N probably damaging Het
Kcnj8 T C 6: 142,566,047 Y278C probably damaging Het
Lama3 G A 18: 12,482,148 probably null Het
Lax1 C T 1: 133,679,792 D404N probably benign Het
Lipg T C 18: 74,948,024 K329E probably damaging Het
Lysmd2 T G 9: 75,635,702 L197R probably damaging Het
Maneal A T 4: 124,857,171 I264N probably damaging Het
Myh4 A G 11: 67,258,629 N1729S probably benign Het
Myl2 A G 5: 122,106,728 N154D possibly damaging Het
Nlrp9c T A 7: 26,382,387 D638V probably damaging Het
Notch1 T C 2: 26,472,098 H74R unknown Het
Olfml3 A T 3: 103,736,207 V286D possibly damaging Het
Olfr1271 G A 2: 90,265,708 H241Y probably damaging Het
Olfr228 T C 2: 86,483,221 I174V possibly damaging Het
Olfr310 T G 7: 86,268,882 K302N probably benign Het
Olfr559 G T 7: 102,724,080 R137S possibly damaging Het
Olfr562-ps1 A G 7: 102,782,396 K307E probably benign Het
Parn A C 16: 13,656,925 F127V probably damaging Het
Pcdhac2 T C 18: 37,144,705 V246A probably damaging Het
Plin2 G A 4: 86,661,987 T90I possibly damaging Het
Podxl C T 6: 31,525,046 C326Y probably damaging Het
Prl8a8 T A 13: 27,507,352 K223* probably null Het
Rtn1 A C 12: 72,308,329 V281G probably damaging Het
Scaf8 T C 17: 3,171,119 S294P unknown Het
Shroom3 C A 5: 92,941,561 N723K probably benign Het
Spata22 T C 11: 73,353,746 *312R probably null Het
Stx7 T C 10: 24,185,071 probably null Het
Taar6 T C 10: 23,985,123 D175G probably benign Het
Tbccd1 A C 16: 22,822,466 L387R probably damaging Het
Tecpr1 T C 5: 144,209,974 M525V probably benign Het
Tex10 A T 4: 48,436,450 I756N probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn T C 2: 76,741,997 E24438G probably damaging Het
Wdpcp C T 11: 21,711,631 T301I possibly damaging Het
Zbtb1 C T 12: 76,386,473 T411I probably benign Het
Zcchc11 A G 4: 108,526,805 K1053R probably damaging Het
Zzef1 G A 11: 72,913,303 G2624R probably benign Het
Other mutations in Ptprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Ptprh APN 7 4580916 missense probably benign 0.23
IGL02420:Ptprh APN 7 4580930 missense probably damaging 1.00
IGL02619:Ptprh APN 7 4549499 missense probably damaging 1.00
IGL02729:Ptprh APN 7 4580874 missense probably damaging 0.99
R0018:Ptprh UTSW 7 4601846 critical splice donor site probably null
R0049:Ptprh UTSW 7 4573362 missense possibly damaging 0.80
R0449:Ptprh UTSW 7 4598006 missense probably damaging 1.00
R0477:Ptprh UTSW 7 4597998 missense possibly damaging 0.87
R0626:Ptprh UTSW 7 4564272 missense probably benign 0.00
R0741:Ptprh UTSW 7 4554173 critical splice donor site probably null
R1068:Ptprh UTSW 7 4549463 missense possibly damaging 0.89
R1226:Ptprh UTSW 7 4603092 nonsense probably null
R1487:Ptprh UTSW 7 4552738 missense probably damaging 1.00
R1495:Ptprh UTSW 7 4580889 missense probably benign 0.02
R1537:Ptprh UTSW 7 4549699 missense probably damaging 1.00
R1601:Ptprh UTSW 7 4552638 missense probably damaging 1.00
R1731:Ptprh UTSW 7 4601913 missense probably benign 0.00
R1920:Ptprh UTSW 7 4549395 missense probably benign 0.25
R2082:Ptprh UTSW 7 4550775 missense probably damaging 1.00
R2180:Ptprh UTSW 7 4601868 missense probably benign 0.26
R2214:Ptprh UTSW 7 4552922 missense possibly damaging 0.78
R2245:Ptprh UTSW 7 4573346 missense probably benign 0.09
R2271:Ptprh UTSW 7 4603133 start gained probably benign
R3693:Ptprh UTSW 7 4554235 missense probably damaging 0.99
R3713:Ptprh UTSW 7 4571970 missense probably damaging 1.00
R4081:Ptprh UTSW 7 4580988 missense probably damaging 0.99
R4205:Ptprh UTSW 7 4597992 missense probably damaging 1.00
R4689:Ptprh UTSW 7 4597997 missense possibly damaging 0.74
R4782:Ptprh UTSW 7 4569577 missense probably benign 0.08
R4838:Ptprh UTSW 7 4573430 missense possibly damaging 0.78
R4974:Ptprh UTSW 7 4551007 splice site probably null
R5218:Ptprh UTSW 7 4597920 missense probably benign 0.05
R5430:Ptprh UTSW 7 4551047 missense probably damaging 1.00
R5533:Ptprh UTSW 7 4549505 missense probably damaging 1.00
R5544:Ptprh UTSW 7 4580910 nonsense probably null
R5547:Ptprh UTSW 7 4554222 nonsense probably null
R5869:Ptprh UTSW 7 4601940 missense probably benign 0.00
R5928:Ptprh UTSW 7 4573508 missense probably damaging 1.00
R6063:Ptprh UTSW 7 4573362 missense possibly damaging 0.80
R6112:Ptprh UTSW 7 4597923 missense probably benign 0.01
R6733:Ptprh UTSW 7 4603044 splice site probably null
R6836:Ptprh UTSW 7 4551135 missense probably damaging 1.00
R6859:Ptprh UTSW 7 4549371 nonsense probably null
R6868:Ptprh UTSW 7 4601865 missense probably benign
R7015:Ptprh UTSW 7 4552627 critical splice donor site probably null
R7092:Ptprh UTSW 7 4580861 critical splice donor site probably null
R7147:Ptprh UTSW 7 4550782 missense probably damaging 1.00
R7177:Ptprh UTSW 7 4569481 missense possibly damaging 0.77
R7358:Ptprh UTSW 7 4551007 splice site probably null
R7436:Ptprh UTSW 7 4552743 missense probably damaging 1.00
R7512:Ptprh UTSW 7 4571781 missense possibly damaging 0.60
RF022:Ptprh UTSW 7 4549368 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGGCATGAGTAGTATGGGCTAC -3'
(R):5'- AGGAACAACGCTGATTTCCC -3'

Sequencing Primer
(F):5'- GGGCTACATACTCAGAACATATTAAC -3'
(R):5'- GGAACAACGCTGATTTCCCTTTTTG -3'
Posted On2018-06-06