Incidental Mutation 'R6491:Pxmp4'
ID522847
Institutional Source Beutler Lab
Gene Symbol Pxmp4
Ensembl Gene ENSMUSG00000000876
Gene Nameperoxisomal membrane protein 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6491 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location154585758-154603708 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 154592163 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000896] [ENSMUST00000109703]
Predicted Effect probably null
Transcript: ENSMUST00000000896
SMART Domains Protein: ENSMUSP00000000896
Gene: ENSMUSG00000000876

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Tim17 20 141 1.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109703
SMART Domains Protein: ENSMUSP00000105325
Gene: ENSMUSG00000000876

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Tim17 20 78 2e-10 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,475,972 L431P probably damaging Het
Acad10 A C 5: 121,630,157 W779G probably damaging Het
Acrbp A G 6: 125,051,479 probably benign Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
Ap2a1 A T 7: 44,916,164 I93K probably damaging Het
Arnt T A 3: 95,476,143 M240K probably damaging Het
Ceacam12 A T 7: 18,069,260 K197M probably damaging Het
Cep41 T C 6: 30,656,484 N323S probably benign Het
Dst A G 1: 34,193,012 T2904A probably benign Het
Eml1 G A 12: 108,513,071 probably null Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Irf2bpl A G 12: 86,883,464 V145A probably benign Het
Itga2b T C 11: 102,459,869 probably null Het
Itga8 T C 2: 12,204,776 D466G probably damaging Het
Kdm4c G T 4: 74,373,636 C830F probably damaging Het
Mrps27 T C 13: 99,363,030 S73P probably damaging Het
Mtdh T G 15: 34,116,327 N17K probably damaging Het
Muc3a A G 5: 137,212,128 S9P probably benign Het
Olfr910 A G 9: 38,647,455 L23P probably damaging Het
Oxgr1 T A 14: 120,022,007 I263F probably benign Het
Phc1 A G 6: 122,334,964 Het
Ppp2r5d A G 17: 46,685,583 F388S probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 A G 4: 100,409,912 N270S possibly damaging Het
Slc7a14 T C 3: 31,223,944 Y504C probably damaging Het
Snx9 A G 17: 5,920,162 D391G probably benign Het
St18 T A 1: 6,827,985 Y670* probably null Het
Tjp1 A T 7: 65,337,117 F207I possibly damaging Het
Trappc3 A G 4: 126,275,229 I171V probably benign Het
Ugt2b5 A T 5: 87,125,469 L446* probably null Het
Vmn2r105 A T 17: 20,227,730 Y277* probably null Het
Vmn2r11 A T 5: 109,048,934 N557K possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp938 A G 10: 82,227,529 *65Q probably null Het
Other mutations in Pxmp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02245:Pxmp4 APN 2 154587950 missense probably damaging 1.00
R0141:Pxmp4 UTSW 2 154592295 missense probably damaging 0.99
R3904:Pxmp4 UTSW 2 154588049 missense probably damaging 1.00
R6543:Pxmp4 UTSW 2 154588059 missense possibly damaging 0.82
RF010:Pxmp4 UTSW 2 154592263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCCTTGGATTCCAGCTG -3'
(R):5'- TTCTGAAAGCCACGTACATCC -3'

Sequencing Primer
(F):5'- AGGTCTCTACGATTTCAAGGCCAG -3'
(R):5'- CACTCTCGGAACCTAGCCTG -3'
Posted On2018-06-06