Incidental Mutation 'R6493:Cers3'
ID522850
Institutional Source Beutler Lab
Gene Symbol Cers3
Ensembl Gene ENSMUSG00000030510
Gene Nameceramide synthase 3
Synonymsrelated to TRH3, Lass3, T3L, CerS3, 4930550L11Rik, LOC233330
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R6493 (G1)
Quality Score221.009
Status Not validated
Chromosome7
Chromosomal Location66743504-66823691 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66743720 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 26 (Y26H)
Ref Sequence ENSEMBL: ENSMUSP00000069238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066475]
Predicted Effect probably benign
Transcript: ENSMUST00000066475
AA Change: Y26H

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000069238
Gene: ENSMUSG00000030510
AA Change: Y26H

DomainStartEndE-ValueType
transmembrane domain 66 88 N/A INTRINSIC
HOX 110 167 2.48e-2 SMART
TLC 166 367 6.52e-57 SMART
low complexity region 379 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209081
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ceramide synthase family of genes. The ceramide synthase enzymes regulate sphingolipid synthesis by catalyzing the formation of ceramides from sphingoid base and acyl-coA substrates. This family member is involved in the synthesis of ceramides with ultra-long-chain acyl moieties (ULC-Cers), important to the epidermis in its role in creating a protective barrier from the environment. The protein encoded by this gene has also been implicated in modification of the lipid structures required for spermatogenesis. Mutations in this gene have been associated with male fertility defects, and epidermal defects, including ichthyosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a lethal skin barrier disruption defect due to a lack of ultra-long-chain acyl ceramides, impaired stratum corneum desquamation, accelerated lamellar body biogenesis and extrusion, and delayed keratinocyte cornification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,293,878 H934L probably benign Het
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Ampd3 A G 7: 110,795,811 probably null Het
Axdnd1 A T 1: 156,380,813 I485N probably damaging Het
Bscl2 A G 19: 8,839,774 D22G probably damaging Het
Ccdc96 A G 5: 36,486,252 E534G probably damaging Het
Cdc42bpg G T 19: 6,318,455 G1061V probably damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Daxx T A 17: 33,912,371 probably null Het
Egf T C 3: 129,719,088 probably benign Het
Eps15 A G 4: 109,368,948 D629G probably damaging Het
Fancm G A 12: 65,097,488 A575T probably benign Het
Fat4 G A 3: 38,890,887 D1310N probably damaging Het
Gm10424 A G 5: 95,270,825 L104P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Grxcr2 G A 18: 41,998,701 P101L possibly damaging Het
Hsd17b12 A T 2: 94,043,883 I225N probably damaging Het
Kcnj8 T C 6: 142,566,047 Y278C probably damaging Het
Lama3 G A 18: 12,482,148 probably null Het
Lax1 C T 1: 133,679,792 D404N probably benign Het
Lipg T C 18: 74,948,024 K329E probably damaging Het
Lysmd2 T G 9: 75,635,702 L197R probably damaging Het
Maneal A T 4: 124,857,171 I264N probably damaging Het
Myh4 A G 11: 67,258,629 N1729S probably benign Het
Myl2 A G 5: 122,106,728 N154D possibly damaging Het
Nlrp9c T A 7: 26,382,387 D638V probably damaging Het
Notch1 T C 2: 26,472,098 H74R unknown Het
Olfml3 A T 3: 103,736,207 V286D possibly damaging Het
Olfr1271 G A 2: 90,265,708 H241Y probably damaging Het
Olfr228 T C 2: 86,483,221 I174V possibly damaging Het
Olfr310 T G 7: 86,268,882 K302N probably benign Het
Olfr559 G T 7: 102,724,080 R137S possibly damaging Het
Olfr562-ps1 A G 7: 102,782,396 K307E probably benign Het
Parn A C 16: 13,656,925 F127V probably damaging Het
Pcdhac2 T C 18: 37,144,705 V246A probably damaging Het
Plin2 G A 4: 86,661,987 T90I possibly damaging Het
Podxl C T 6: 31,525,046 C326Y probably damaging Het
Prl8a8 T A 13: 27,507,352 K223* probably null Het
Ptprh T G 7: 4,580,990 E201A possibly damaging Het
Rtn1 A C 12: 72,308,329 V281G probably damaging Het
Scaf8 T C 17: 3,171,119 S294P unknown Het
Shroom3 C A 5: 92,941,561 N723K probably benign Het
Spata22 T C 11: 73,353,746 *312R probably null Het
Stx7 T C 10: 24,185,071 probably null Het
Taar6 T C 10: 23,985,123 D175G probably benign Het
Tbccd1 A C 16: 22,822,466 L387R probably damaging Het
Tecpr1 T C 5: 144,209,974 M525V probably benign Het
Tex10 A T 4: 48,436,450 I756N probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn T C 2: 76,741,997 E24438G probably damaging Het
Wdpcp C T 11: 21,711,631 T301I possibly damaging Het
Zbtb1 C T 12: 76,386,473 T411I probably benign Het
Zcchc11 A G 4: 108,526,805 K1053R probably damaging Het
Zzef1 G A 11: 72,913,303 G2624R probably benign Het
Other mutations in Cers3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Cers3 APN 7 66786003 splice site probably benign
IGL02832:Cers3 APN 7 66781825 missense probably benign 0.00
R0400:Cers3 UTSW 7 66764330 missense probably benign 0.03
R0490:Cers3 UTSW 7 66773690 missense possibly damaging 0.69
R0558:Cers3 UTSW 7 66783418 missense probably damaging 1.00
R0571:Cers3 UTSW 7 66786057 missense possibly damaging 0.93
R1452:Cers3 UTSW 7 66783404 missense probably damaging 1.00
R1538:Cers3 UTSW 7 66781823 missense probably damaging 0.98
R1767:Cers3 UTSW 7 66783403 missense probably damaging 1.00
R2155:Cers3 UTSW 7 66783414 missense probably damaging 0.99
R2427:Cers3 UTSW 7 66795793 missense probably benign 0.04
R3705:Cers3 UTSW 7 66786075 missense probably benign 0.25
R3713:Cers3 UTSW 7 66786075 missense probably benign 0.25
R3714:Cers3 UTSW 7 66786075 missense probably benign 0.25
R3715:Cers3 UTSW 7 66786075 missense probably benign 0.25
R3961:Cers3 UTSW 7 66786075 missense probably benign 0.25
R3963:Cers3 UTSW 7 66786075 missense probably benign 0.25
R4238:Cers3 UTSW 7 66773676 missense probably damaging 1.00
R4652:Cers3 UTSW 7 66781856 splice site probably null
R5174:Cers3 UTSW 7 66784868 missense probably damaging 1.00
R6675:Cers3 UTSW 7 66786096 missense possibly damaging 0.50
R6807:Cers3 UTSW 7 66764220 missense probably damaging 1.00
R6833:Cers3 UTSW 7 66779671 critical splice donor site probably null
R7223:Cers3 UTSW 7 66783415 missense probably damaging 0.99
R7592:Cers3 UTSW 7 66789629 missense probably damaging 1.00
R7835:Cers3 UTSW 7 66773639 missense possibly damaging 0.79
R7918:Cers3 UTSW 7 66773639 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ATCCAGTAGCTTTGCCTCACG -3'
(R):5'- GTCAAAACCTTCAGGCAGGAGG -3'

Sequencing Primer
(F):5'- GCCTCACGTGACTAACTGC -3'
(R):5'- GGAGGCTGCAAAACTCTCTTC -3'
Posted On2018-06-06