Incidental Mutation 'R6493:Cers3'
ID 522850
Institutional Source Beutler Lab
Gene Symbol Cers3
Ensembl Gene ENSMUSG00000030510
Gene Name ceramide synthase 3
Synonyms T3L, related to TRH3, Lass3, CerS3, 4930550L11Rik, LOC233330
MMRRC Submission 044625-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.264) question?
Stock # R6493 (G1)
Quality Score 221.009
Status Not validated
Chromosome 7
Chromosomal Location 66393252-66473439 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66393468 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 26 (Y26H)
Ref Sequence ENSEMBL: ENSMUSP00000069238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066475]
AlphaFold Q1A3B0
Predicted Effect probably benign
Transcript: ENSMUST00000066475
AA Change: Y26H

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000069238
Gene: ENSMUSG00000030510
AA Change: Y26H

DomainStartEndE-ValueType
transmembrane domain 66 88 N/A INTRINSIC
HOX 110 167 2.48e-2 SMART
TLC 166 367 6.52e-57 SMART
low complexity region 379 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209081
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ceramide synthase family of genes. The ceramide synthase enzymes regulate sphingolipid synthesis by catalyzing the formation of ceramides from sphingoid base and acyl-coA substrates. This family member is involved in the synthesis of ceramides with ultra-long-chain acyl moieties (ULC-Cers), important to the epidermis in its role in creating a protective barrier from the environment. The protein encoded by this gene has also been implicated in modification of the lipid structures required for spermatogenesis. Mutations in this gene have been associated with male fertility defects, and epidermal defects, including ichthyosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a lethal skin barrier disruption defect due to a lack of ultra-long-chain acyl ceramides, impaired stratum corneum desquamation, accelerated lamellar body biogenesis and extrusion, and delayed keratinocyte cornification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,184,704 (GRCm39) H934L probably benign Het
Abcb1b G A 5: 8,874,698 (GRCm39) D453N probably damaging Het
Ampd3 A G 7: 110,395,018 (GRCm39) probably null Het
Axdnd1 A T 1: 156,208,383 (GRCm39) I485N probably damaging Het
Bscl2 A G 19: 8,817,138 (GRCm39) D22G probably damaging Het
Ccdc96 A G 5: 36,643,596 (GRCm39) E534G probably damaging Het
Cdc42bpg G T 19: 6,368,485 (GRCm39) G1061V probably damaging Het
Chd1l G A 3: 97,494,483 (GRCm39) A399V probably damaging Het
Clca4a T A 3: 144,663,059 (GRCm39) T597S probably benign Het
Daxx T A 17: 34,131,345 (GRCm39) probably null Het
Egf T C 3: 129,512,737 (GRCm39) probably benign Het
Eps15 A G 4: 109,226,145 (GRCm39) D629G probably damaging Het
Fancm G A 12: 65,144,262 (GRCm39) A575T probably benign Het
Fat4 G A 3: 38,945,036 (GRCm39) D1310N probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Grxcr2 G A 18: 42,131,766 (GRCm39) P101L possibly damaging Het
Hsd17b12 A T 2: 93,874,228 (GRCm39) I225N probably damaging Het
Kcnj8 T C 6: 142,511,773 (GRCm39) Y278C probably damaging Het
Lama3 G A 18: 12,615,205 (GRCm39) probably null Het
Lax1 C T 1: 133,607,530 (GRCm39) D404N probably benign Het
Lipg T C 18: 75,081,095 (GRCm39) K329E probably damaging Het
Lysmd2 T G 9: 75,542,984 (GRCm39) L197R probably damaging Het
Maneal A T 4: 124,750,964 (GRCm39) I264N probably damaging Het
Myh4 A G 11: 67,149,455 (GRCm39) N1729S probably benign Het
Myl2 A G 5: 122,244,791 (GRCm39) N154D possibly damaging Het
Nlrp9c T A 7: 26,081,812 (GRCm39) D638V probably damaging Het
Notch1 T C 2: 26,362,110 (GRCm39) H74R unknown Het
Olfml3 A T 3: 103,643,523 (GRCm39) V286D possibly damaging Het
Or14c46 T G 7: 85,918,090 (GRCm39) K302N probably benign Het
Or4b12 G A 2: 90,096,052 (GRCm39) H241Y probably damaging Het
Or51a25 G T 7: 102,373,287 (GRCm39) R137S possibly damaging Het
Or51f23c-ps1 A G 7: 102,431,603 (GRCm39) K307E probably benign Het
Or8k41 T C 2: 86,313,565 (GRCm39) I174V possibly damaging Het
Parn A C 16: 13,474,789 (GRCm39) F127V probably damaging Het
Pcdhac2 T C 18: 37,277,758 (GRCm39) V246A probably damaging Het
Plin2 G A 4: 86,580,224 (GRCm39) T90I possibly damaging Het
Podxl C T 6: 31,501,981 (GRCm39) C326Y probably damaging Het
Pramel46 A G 5: 95,418,684 (GRCm39) L104P probably damaging Het
Prl8a8 T A 13: 27,691,335 (GRCm39) K223* probably null Het
Ptprh T G 7: 4,583,989 (GRCm39) E201A possibly damaging Het
Rtn1 A C 12: 72,355,103 (GRCm39) V281G probably damaging Het
Scaf8 T C 17: 3,221,394 (GRCm39) S294P unknown Het
Shroom3 C A 5: 93,089,420 (GRCm39) N723K probably benign Het
Spata22 T C 11: 73,244,572 (GRCm39) *312R probably null Het
Stx7 T C 10: 24,060,969 (GRCm39) probably null Het
Taar6 T C 10: 23,861,021 (GRCm39) D175G probably benign Het
Tbccd1 A C 16: 22,641,216 (GRCm39) L387R probably damaging Het
Tecpr1 T C 5: 144,146,792 (GRCm39) M525V probably benign Het
Tex10 A T 4: 48,436,450 (GRCm39) I756N probably damaging Het
Tfap2d G C 1: 19,174,702 (GRCm39) G52R probably benign Het
Ttn T C 2: 76,572,341 (GRCm39) E24438G probably damaging Het
Tut4 A G 4: 108,384,002 (GRCm39) K1053R probably damaging Het
Wdpcp C T 11: 21,661,631 (GRCm39) T301I possibly damaging Het
Zbtb1 C T 12: 76,433,247 (GRCm39) T411I probably benign Het
Zzef1 G A 11: 72,804,129 (GRCm39) G2624R probably benign Het
Other mutations in Cers3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Cers3 APN 7 66,435,751 (GRCm39) splice site probably benign
IGL02832:Cers3 APN 7 66,431,573 (GRCm39) missense probably benign 0.00
R0400:Cers3 UTSW 7 66,414,078 (GRCm39) missense probably benign 0.03
R0490:Cers3 UTSW 7 66,423,438 (GRCm39) missense possibly damaging 0.69
R0558:Cers3 UTSW 7 66,433,166 (GRCm39) missense probably damaging 1.00
R0571:Cers3 UTSW 7 66,435,805 (GRCm39) missense possibly damaging 0.93
R1452:Cers3 UTSW 7 66,433,152 (GRCm39) missense probably damaging 1.00
R1538:Cers3 UTSW 7 66,431,571 (GRCm39) missense probably damaging 0.98
R1767:Cers3 UTSW 7 66,433,151 (GRCm39) missense probably damaging 1.00
R2155:Cers3 UTSW 7 66,433,162 (GRCm39) missense probably damaging 0.99
R2427:Cers3 UTSW 7 66,445,541 (GRCm39) missense probably benign 0.04
R3705:Cers3 UTSW 7 66,435,823 (GRCm39) missense probably benign 0.25
R3713:Cers3 UTSW 7 66,435,823 (GRCm39) missense probably benign 0.25
R3714:Cers3 UTSW 7 66,435,823 (GRCm39) missense probably benign 0.25
R3715:Cers3 UTSW 7 66,435,823 (GRCm39) missense probably benign 0.25
R3961:Cers3 UTSW 7 66,435,823 (GRCm39) missense probably benign 0.25
R3963:Cers3 UTSW 7 66,435,823 (GRCm39) missense probably benign 0.25
R4238:Cers3 UTSW 7 66,423,424 (GRCm39) missense probably damaging 1.00
R4652:Cers3 UTSW 7 66,431,604 (GRCm39) splice site probably null
R5174:Cers3 UTSW 7 66,434,616 (GRCm39) missense probably damaging 1.00
R6675:Cers3 UTSW 7 66,435,844 (GRCm39) missense possibly damaging 0.50
R6807:Cers3 UTSW 7 66,413,968 (GRCm39) missense probably damaging 1.00
R6833:Cers3 UTSW 7 66,429,419 (GRCm39) critical splice donor site probably null
R7223:Cers3 UTSW 7 66,433,163 (GRCm39) missense probably damaging 0.99
R7592:Cers3 UTSW 7 66,439,377 (GRCm39) missense probably damaging 1.00
R7835:Cers3 UTSW 7 66,423,387 (GRCm39) missense possibly damaging 0.79
R8202:Cers3 UTSW 7 66,435,761 (GRCm39) missense probably damaging 0.99
R8322:Cers3 UTSW 7 66,439,386 (GRCm39) missense probably damaging 1.00
R8350:Cers3 UTSW 7 66,414,090 (GRCm39) missense possibly damaging 0.54
R8450:Cers3 UTSW 7 66,414,090 (GRCm39) missense possibly damaging 0.54
R8757:Cers3 UTSW 7 66,435,850 (GRCm39) missense probably damaging 1.00
R8759:Cers3 UTSW 7 66,435,850 (GRCm39) missense probably damaging 1.00
R9149:Cers3 UTSW 7 66,393,442 (GRCm39) missense probably benign 0.07
R9712:Cers3 UTSW 7 66,423,378 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCCAGTAGCTTTGCCTCACG -3'
(R):5'- GTCAAAACCTTCAGGCAGGAGG -3'

Sequencing Primer
(F):5'- GCCTCACGTGACTAACTGC -3'
(R):5'- GGAGGCTGCAAAACTCTCTTC -3'
Posted On 2018-06-06