Incidental Mutation 'R6491:Arnt'
ID522851
Institutional Source Beutler Lab
Gene Symbol Arnt
Ensembl Gene ENSMUSG00000015522
Gene Namearyl hydrocarbon receptor nuclear translocator
SynonymsESTM42, Hif1b, D3Ertd557e, bHLHe2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6491 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location95434388-95497240 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95476143 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 240 (M240K)
Ref Sequence ENSEMBL: ENSMUSP00000102779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015666] [ENSMUST00000090804] [ENSMUST00000102749] [ENSMUST00000107161] [ENSMUST00000136413]
Predicted Effect probably damaging
Transcript: ENSMUST00000015666
AA Change: M235K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000015666
Gene: ENSMUSG00000015522
AA Change: M235K

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 69 128 2.9e-11 SMART
PAS 143 210 7.4e-13 SMART
low complexity region 231 242 N/A INTRINSIC
PAS 332 397 7.6e-10 SMART
PAC 404 447 9.6e-7 SMART
low complexity region 705 718 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090804
AA Change: M240K

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088313
Gene: ENSMUSG00000015522
AA Change: M240K

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 80 133 1e-14 SMART
PAS 148 215 1.51e-10 SMART
low complexity region 236 247 N/A INTRINSIC
PAS 337 402 1.55e-7 SMART
PAC 409 452 1.95e-4 SMART
low complexity region 710 723 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102749
AA Change: M255K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099810
Gene: ENSMUSG00000015522
AA Change: M255K

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 95 148 1e-14 SMART
PAS 163 230 1.51e-10 SMART
low complexity region 251 262 N/A INTRINSIC
PAS 352 417 1.55e-7 SMART
PAC 424 467 1.95e-4 SMART
low complexity region 725 738 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107161
AA Change: M240K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102779
Gene: ENSMUSG00000015522
AA Change: M240K

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 80 133 1e-14 SMART
PAS 148 215 1.51e-10 SMART
low complexity region 236 247 N/A INTRINSIC
PAS 337 402 1.55e-7 SMART
PAC 409 452 1.95e-4 SMART
low complexity region 694 707 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136413
AA Change: M16K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116688
Gene: ENSMUSG00000015522
AA Change: M16K

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Blast:PAS 97 126 7e-8 BLAST
PDB:2B02|A 97 126 5e-9 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156653
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a basic helix-loop-helix domain and two characteristic PAS domains along with a PAC domain. The encoded protein binds to ligand-bound aryl hydrocarbon receptor and aids in the movement of this complex to the nucleus, where it promotes the expression of genes involved in xenobiotic metabolism. This protein is also a co-factor for transcriptional regulation by hypoxia-inducible factor 1. Chromosomal translocation of this locus with the ETV6 (ets variant 6) gene on chromosome 12 have been described in leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit loss of aryl hydrocarbon receptor and hypoxia-inducible factor 1 alpha gene induction, defective angiogenesis of the yolk sac and branchial arches, placental defects, and lethality by embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,475,972 L431P probably damaging Het
Acad10 A C 5: 121,630,157 W779G probably damaging Het
Acrbp A G 6: 125,051,479 probably benign Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
Ap2a1 A T 7: 44,916,164 I93K probably damaging Het
Ceacam12 A T 7: 18,069,260 K197M probably damaging Het
Cep41 T C 6: 30,656,484 N323S probably benign Het
Dst A G 1: 34,193,012 T2904A probably benign Het
Eml1 G A 12: 108,513,071 probably null Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Irf2bpl A G 12: 86,883,464 V145A probably benign Het
Itga2b T C 11: 102,459,869 probably null Het
Itga8 T C 2: 12,204,776 D466G probably damaging Het
Kdm4c G T 4: 74,373,636 C830F probably damaging Het
Mrps27 T C 13: 99,363,030 S73P probably damaging Het
Mtdh T G 15: 34,116,327 N17K probably damaging Het
Muc3a A G 5: 137,212,128 S9P probably benign Het
Olfr910 A G 9: 38,647,455 L23P probably damaging Het
Oxgr1 T A 14: 120,022,007 I263F probably benign Het
Phc1 A G 6: 122,334,964 Het
Ppp2r5d A G 17: 46,685,583 F388S probably damaging Het
Pxmp4 A G 2: 154,592,163 probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 A G 4: 100,409,912 N270S possibly damaging Het
Slc7a14 T C 3: 31,223,944 Y504C probably damaging Het
Snx9 A G 17: 5,920,162 D391G probably benign Het
St18 T A 1: 6,827,985 Y670* probably null Het
Tjp1 A T 7: 65,337,117 F207I possibly damaging Het
Trappc3 A G 4: 126,275,229 I171V probably benign Het
Ugt2b5 A T 5: 87,125,469 L446* probably null Het
Vmn2r105 A T 17: 20,227,730 Y277* probably null Het
Vmn2r11 A T 5: 109,048,934 N557K possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp938 A G 10: 82,227,529 *65Q probably null Het
Other mutations in Arnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Arnt APN 3 95490340 missense probably damaging 0.98
IGL00949:Arnt APN 3 95487268 missense probably damaging 1.00
IGL01304:Arnt APN 3 95448385 missense probably damaging 1.00
IGL01634:Arnt APN 3 95470398 splice site probably benign
IGL01685:Arnt APN 3 95474681 missense probably damaging 1.00
IGL01768:Arnt APN 3 95491016 unclassified probably benign
IGL02738:Arnt APN 3 95495320 unclassified probably null
IGL02941:Arnt APN 3 95460370 splice site probably benign
R0211:Arnt UTSW 3 95476149 missense probably damaging 1.00
R0211:Arnt UTSW 3 95476149 missense probably damaging 1.00
R0420:Arnt UTSW 3 95470394 splice site probably benign
R0801:Arnt UTSW 3 95493846 missense possibly damaging 0.86
R1418:Arnt UTSW 3 95470399 splice site probably benign
R1523:Arnt UTSW 3 95489654 missense possibly damaging 0.77
R1956:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1957:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1958:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1969:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1970:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1971:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R3743:Arnt UTSW 3 95474705 missense possibly damaging 0.49
R4561:Arnt UTSW 3 95452613 missense probably damaging 0.96
R4780:Arnt UTSW 3 95488385 missense probably damaging 1.00
R4827:Arnt UTSW 3 95489913 unclassified probably null
R4913:Arnt UTSW 3 95490654 missense probably damaging 1.00
R5051:Arnt UTSW 3 95470337 missense probably benign 0.08
R5572:Arnt UTSW 3 95474704 missense possibly damaging 0.49
R5866:Arnt UTSW 3 95490726 unclassified probably benign
R6376:Arnt UTSW 3 95490625 missense probably damaging 0.99
R6873:Arnt UTSW 3 95474575 missense probably damaging 1.00
R6920:Arnt UTSW 3 95490621 missense probably damaging 0.99
R7485:Arnt UTSW 3 95495348 missense probably damaging 1.00
R7731:Arnt UTSW 3 95483775 missense probably benign 0.33
R7786:Arnt UTSW 3 95484956 missense probably damaging 0.96
R7797:Arnt UTSW 3 95480261 critical splice donor site probably null
X0020:Arnt UTSW 3 95494565 missense probably benign 0.10
X0026:Arnt UTSW 3 95474630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACGGAATCTGGAAGGCTTG -3'
(R):5'- CAACTGTGCCTTAACTGTAATTCAC -3'

Sequencing Primer
(F):5'- TGGCTGGACCCAAGCTTTG -3'
(R):5'- TGGTAAAACAACTGGTTCTTGAAAG -3'
Posted On2018-06-06