Incidental Mutation 'R6493:Olfr310'
ID522852
Institutional Source Beutler Lab
Gene Symbol Olfr310
Ensembl Gene ENSMUSG00000057540
Gene Nameolfactory receptor 310
SynonymsGA_x6K02T2NHDJ-9838699-9839697, MOR227-6P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6493 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86268487-86277172 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 86268882 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 302 (K302N)
Ref Sequence ENSEMBL: ENSMUSP00000151989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081918] [ENSMUST00000217724]
Predicted Effect probably benign
Transcript: ENSMUST00000081918
AA Change: K302N

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000080589
Gene: ENSMUSG00000057540
AA Change: K302N

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 8.9e-46 PFAM
Pfam:7tm_1 39 289 1.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217724
AA Change: K302N

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,293,878 H934L probably benign Het
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Ampd3 A G 7: 110,795,811 probably null Het
Axdnd1 A T 1: 156,380,813 I485N probably damaging Het
Bscl2 A G 19: 8,839,774 D22G probably damaging Het
Ccdc96 A G 5: 36,486,252 E534G probably damaging Het
Cdc42bpg G T 19: 6,318,455 G1061V probably damaging Het
Cers3 T C 7: 66,743,720 Y26H probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Daxx T A 17: 33,912,371 probably null Het
Egf T C 3: 129,719,088 probably benign Het
Eps15 A G 4: 109,368,948 D629G probably damaging Het
Fancm G A 12: 65,097,488 A575T probably benign Het
Fat4 G A 3: 38,890,887 D1310N probably damaging Het
Gm10424 A G 5: 95,270,825 L104P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Grxcr2 G A 18: 41,998,701 P101L possibly damaging Het
Hsd17b12 A T 2: 94,043,883 I225N probably damaging Het
Kcnj8 T C 6: 142,566,047 Y278C probably damaging Het
Lama3 G A 18: 12,482,148 probably null Het
Lax1 C T 1: 133,679,792 D404N probably benign Het
Lipg T C 18: 74,948,024 K329E probably damaging Het
Lysmd2 T G 9: 75,635,702 L197R probably damaging Het
Maneal A T 4: 124,857,171 I264N probably damaging Het
Myh4 A G 11: 67,258,629 N1729S probably benign Het
Myl2 A G 5: 122,106,728 N154D possibly damaging Het
Nlrp9c T A 7: 26,382,387 D638V probably damaging Het
Notch1 T C 2: 26,472,098 H74R unknown Het
Olfml3 A T 3: 103,736,207 V286D possibly damaging Het
Olfr1271 G A 2: 90,265,708 H241Y probably damaging Het
Olfr228 T C 2: 86,483,221 I174V possibly damaging Het
Olfr559 G T 7: 102,724,080 R137S possibly damaging Het
Olfr562-ps1 A G 7: 102,782,396 K307E probably benign Het
Parn A C 16: 13,656,925 F127V probably damaging Het
Pcdhac2 T C 18: 37,144,705 V246A probably damaging Het
Plin2 G A 4: 86,661,987 T90I possibly damaging Het
Podxl C T 6: 31,525,046 C326Y probably damaging Het
Prl8a8 T A 13: 27,507,352 K223* probably null Het
Ptprh T G 7: 4,580,990 E201A possibly damaging Het
Rtn1 A C 12: 72,308,329 V281G probably damaging Het
Scaf8 T C 17: 3,171,119 S294P unknown Het
Shroom3 C A 5: 92,941,561 N723K probably benign Het
Spata22 T C 11: 73,353,746 *312R probably null Het
Stx7 T C 10: 24,185,071 probably null Het
Taar6 T C 10: 23,985,123 D175G probably benign Het
Tbccd1 A C 16: 22,822,466 L387R probably damaging Het
Tecpr1 T C 5: 144,209,974 M525V probably benign Het
Tex10 A T 4: 48,436,450 I756N probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn T C 2: 76,741,997 E24438G probably damaging Het
Wdpcp C T 11: 21,711,631 T301I possibly damaging Het
Zbtb1 C T 12: 76,386,473 T411I probably benign Het
Zcchc11 A G 4: 108,526,805 K1053R probably damaging Het
Zzef1 G A 11: 72,913,303 G2624R probably benign Het
Other mutations in Olfr310
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Olfr310 APN 7 86269669 missense probably damaging 1.00
IGL00917:Olfr310 APN 7 86269441 missense probably damaging 1.00
IGL02145:Olfr310 APN 7 86269258 missense probably damaging 1.00
IGL02639:Olfr310 APN 7 86269720 missense probably damaging 0.99
R0139:Olfr310 UTSW 7 86268979 missense probably benign 0.00
R0554:Olfr310 UTSW 7 86269657 missense probably damaging 0.99
R1392:Olfr310 UTSW 7 86268855 missense probably benign 0.01
R1392:Olfr310 UTSW 7 86268855 missense probably benign 0.01
R1474:Olfr310 UTSW 7 86269062 missense probably damaging 1.00
R2379:Olfr310 UTSW 7 86269649 missense probably damaging 1.00
R3692:Olfr310 UTSW 7 86269495 missense probably damaging 1.00
R4290:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R4291:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R4295:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R5071:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5072:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5074:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5828:Olfr310 UTSW 7 86269520 missense probably benign 0.00
R6174:Olfr310 UTSW 7 86268801 missense probably benign
R6207:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R7068:Olfr310 UTSW 7 86269537 missense probably damaging 1.00
R7196:Olfr310 UTSW 7 86269441 missense probably damaging 1.00
R7694:Olfr310 UTSW 7 86269775 missense probably damaging 1.00
R7794:Olfr310 UTSW 7 86269133 missense probably damaging 0.99
Z1176:Olfr310 UTSW 7 86268947 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCCAAATGAAGACTATAGGC -3'
(R):5'- AGGGAAAGCCTTTTCTACCTGTG -3'

Sequencing Primer
(F):5'- TAGAGACTGGGGTAAATATAATCAGG -3'
(R):5'- GAAAGCCTTTTCTACCTGTGTTCCTC -3'
Posted On2018-06-06