Incidental Mutation 'R6491:Kdm4c'
ID522853
Institutional Source Beutler Lab
Gene Symbol Kdm4c
Ensembl Gene ENSMUSG00000028397
Gene Namelysine (K)-specific demethylase 4C
SynonymsJmjd2c, 2410141F18Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001172095; MGI: 1924054

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6491 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location74242497-74405860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 74373636 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 830 (C830F)
Ref Sequence ENSEMBL: ENSMUSP00000077017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030102] [ENSMUST00000077851]
Predicted Effect probably damaging
Transcript: ENSMUST00000030102
AA Change: C830F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030102
Gene: ENSMUSG00000028397
AA Change: C830F

DomainStartEndE-ValueType
JmjN 15 57 9.12e-14 SMART
JmjC 144 310 1.31e-61 SMART
low complexity region 361 374 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
PHD 687 745 3.3e-5 SMART
PHD 807 863 8.71e-5 SMART
TUDOR 875 932 2.96e-10 SMART
TUDOR 933 989 2e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077851
AA Change: C830F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077017
Gene: ENSMUSG00000028397
AA Change: C830F

DomainStartEndE-ValueType
JmjN 15 57 9.12e-14 SMART
JmjC 144 310 1.31e-61 SMART
low complexity region 361 374 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
PHD 687 745 3.3e-5 SMART
PHD 807 863 8.71e-5 SMART
TUDOR 875 932 2.96e-10 SMART
TUDOR 933 989 2e-7 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Jumonji domain 2 (JMJD2) family. The encoded protein is a trimethylation-specific demethylase, and converts specific trimethylated histone residues to the dimethylated form. This enzymatic action regulates gene expression and chromosome segregation. Chromosomal aberrations and changes in expression of this gene may be found in tumor cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null gene trap allele cannot be produced likely due to embryonic lethality. Mice heterozygous for a null gene trap allele exhibit reduced body weight and lower incidence and multiplicity of both benign and malignant tumors in mice treated with DMBA and TPA. [provided by MGI curators]
Allele List at MGI

All alleles(402) : Targeted, other(2) Gene trapped(400)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,475,972 L431P probably damaging Het
Acad10 A C 5: 121,630,157 W779G probably damaging Het
Acrbp A G 6: 125,051,479 probably benign Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
Ap2a1 A T 7: 44,916,164 I93K probably damaging Het
Arnt T A 3: 95,476,143 M240K probably damaging Het
Ceacam12 A T 7: 18,069,260 K197M probably damaging Het
Cep41 T C 6: 30,656,484 N323S probably benign Het
Dst A G 1: 34,193,012 T2904A probably benign Het
Eml1 G A 12: 108,513,071 probably null Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Irf2bpl A G 12: 86,883,464 V145A probably benign Het
Itga2b T C 11: 102,459,869 probably null Het
Itga8 T C 2: 12,204,776 D466G probably damaging Het
Mrps27 T C 13: 99,363,030 S73P probably damaging Het
Mtdh T G 15: 34,116,327 N17K probably damaging Het
Muc3a A G 5: 137,212,128 S9P probably benign Het
Olfr910 A G 9: 38,647,455 L23P probably damaging Het
Oxgr1 T A 14: 120,022,007 I263F probably benign Het
Phc1 A G 6: 122,334,964 Het
Ppp2r5d A G 17: 46,685,583 F388S probably damaging Het
Pxmp4 A G 2: 154,592,163 probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 A G 4: 100,409,912 N270S possibly damaging Het
Slc7a14 T C 3: 31,223,944 Y504C probably damaging Het
Snx9 A G 17: 5,920,162 D391G probably benign Het
St18 T A 1: 6,827,985 Y670* probably null Het
Tjp1 A T 7: 65,337,117 F207I possibly damaging Het
Trappc3 A G 4: 126,275,229 I171V probably benign Het
Ugt2b5 A T 5: 87,125,469 L446* probably null Het
Vmn2r105 A T 17: 20,227,730 Y277* probably null Het
Vmn2r11 A T 5: 109,048,934 N557K possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp938 A G 10: 82,227,529 *65Q probably null Het
Other mutations in Kdm4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Kdm4c APN 4 74345501 missense probably benign 0.19
IGL00225:Kdm4c APN 4 74345567 missense probably benign 0.03
IGL00672:Kdm4c APN 4 74343514 missense probably benign 0.00
IGL00897:Kdm4c APN 4 74373684 missense probably damaging 1.00
IGL01479:Kdm4c APN 4 74343501 missense probably benign 0.18
IGL01707:Kdm4c APN 4 74336927 missense probably damaging 1.00
IGL02142:Kdm4c APN 4 74307016 critical splice donor site probably null
IGL02268:Kdm4c APN 4 74373716 missense possibly damaging 0.94
IGL02662:Kdm4c APN 4 74404821 missense probably damaging 0.99
IGL03377:Kdm4c APN 4 74271255 missense possibly damaging 0.82
3-1:Kdm4c UTSW 4 74334673 missense probably benign 0.00
PIT4434001:Kdm4c UTSW 4 74271332 missense probably benign 0.01
R0096:Kdm4c UTSW 4 74357343 missense probably damaging 1.00
R0096:Kdm4c UTSW 4 74357343 missense probably damaging 1.00
R0219:Kdm4c UTSW 4 74373620 missense probably damaging 1.00
R0309:Kdm4c UTSW 4 74345567 missense probably benign 0.00
R0512:Kdm4c UTSW 4 74333794 missense probably benign
R1070:Kdm4c UTSW 4 74373628 nonsense probably null
R1518:Kdm4c UTSW 4 74333826 missense probably benign
R1713:Kdm4c UTSW 4 74298484 missense probably benign 0.10
R1769:Kdm4c UTSW 4 74280997 missense possibly damaging 0.66
R1927:Kdm4c UTSW 4 74345483 missense probably benign 0.00
R1962:Kdm4c UTSW 4 74307016 intron probably benign
R1992:Kdm4c UTSW 4 74343394 missense possibly damaging 0.71
R2389:Kdm4c UTSW 4 74333870 critical splice donor site probably null
R2979:Kdm4c UTSW 4 74373728 nonsense probably null
R3966:Kdm4c UTSW 4 74298583 missense probably damaging 1.00
R4094:Kdm4c UTSW 4 74311678 missense probably benign
R4171:Kdm4c UTSW 4 74280898 missense possibly damaging 0.73
R4543:Kdm4c UTSW 4 74330760 missense probably benign 0.01
R4581:Kdm4c UTSW 4 74357339 splice site probably null
R5019:Kdm4c UTSW 4 74343535 missense probably damaging 1.00
R5088:Kdm4c UTSW 4 74334699 missense probably benign
R5533:Kdm4c UTSW 4 74315649 intron probably benign
R5663:Kdm4c UTSW 4 74399348 missense probably damaging 1.00
R5691:Kdm4c UTSW 4 74334728 missense probably benign
R5775:Kdm4c UTSW 4 74359431 missense probably damaging 1.00
R5786:Kdm4c UTSW 4 74359485 missense probably damaging 0.98
R6002:Kdm4c UTSW 4 74404969 missense possibly damaging 0.95
R6375:Kdm4c UTSW 4 74330715 missense probably damaging 0.96
R6790:Kdm4c UTSW 4 74391461 missense probably damaging 1.00
R6952:Kdm4c UTSW 4 74357350 missense probably damaging 1.00
R7157:Kdm4c UTSW 4 74345567 missense probably benign 0.01
R7319:Kdm4c UTSW 4 74336963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTCAAAACAGAGAGCGGTG -3'
(R):5'- TGACAGGTCCCAGAAAGAATTC -3'

Sequencing Primer
(F):5'- GCGGTGATTTTTAAAAATACCAAGG -3'
(R):5'- TTCAAATAAAGTGTCAGCAAATGGG -3'
Posted On2018-06-06