Incidental Mutation 'R6491:Trappc3'
ID522857
Institutional Source Beutler Lab
Gene Symbol Trappc3
Ensembl Gene ENSMUSG00000028847
Gene Nametrafficking protein particle complex 3
Synonyms1110058K12Rik, Bet3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R6491 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location126262325-126275883 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126275229 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 171 (I171V)
Ref Sequence ENSEMBL: ENSMUSP00000030660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030660]
PDB Structure
THE CRYSTAL STRUCTURE OF MOUSE BET3P [X-RAY DIFFRACTION]
The crystal structure of truncated mouse bet3p. [X-RAY DIFFRACTION]
THE CRYSTAL STRUCTURE OF THE BET3-TRS31 HETERODIMER. [X-RAY DIFFRACTION]
THE CRYSTAL STRUCTURE OF THE BET3-TRS33-BET5-TRS23 COMPLEX. [X-RAY DIFFRACTION]
The crystal structure of the bet3-trs31-sedlin complex. [X-RAY DIFFRACTION]
Crystal structure of BET3 homolog (13277653) from Mus musculus at 2.04 A resolution [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000030660
AA Change: I171V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030660
Gene: ENSMUSG00000028847
AA Change: I171V

DomainStartEndE-ValueType
Pfam:TRAPP 19 166 1.2e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126786
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the trafficking protein particle complex, which tethers transport vesicles to the cis-Golgi membrane. The encoded protein participates in the regulation of transport from the endoplasmic reticulum to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,475,972 L431P probably damaging Het
Acad10 A C 5: 121,630,157 W779G probably damaging Het
Acrbp A G 6: 125,051,479 probably benign Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
Ap2a1 A T 7: 44,916,164 I93K probably damaging Het
Arnt T A 3: 95,476,143 M240K probably damaging Het
Ceacam12 A T 7: 18,069,260 K197M probably damaging Het
Cep41 T C 6: 30,656,484 N323S probably benign Het
Dst A G 1: 34,193,012 T2904A probably benign Het
Eml1 G A 12: 108,513,071 probably null Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Irf2bpl A G 12: 86,883,464 V145A probably benign Het
Itga2b T C 11: 102,459,869 probably null Het
Itga8 T C 2: 12,204,776 D466G probably damaging Het
Kdm4c G T 4: 74,373,636 C830F probably damaging Het
Mrps27 T C 13: 99,363,030 S73P probably damaging Het
Mtdh T G 15: 34,116,327 N17K probably damaging Het
Muc3a A G 5: 137,212,128 S9P probably benign Het
Olfr910 A G 9: 38,647,455 L23P probably damaging Het
Oxgr1 T A 14: 120,022,007 I263F probably benign Het
Phc1 A G 6: 122,334,964 Het
Ppp2r5d A G 17: 46,685,583 F388S probably damaging Het
Pxmp4 A G 2: 154,592,163 probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 A G 4: 100,409,912 N270S possibly damaging Het
Slc7a14 T C 3: 31,223,944 Y504C probably damaging Het
Snx9 A G 17: 5,920,162 D391G probably benign Het
St18 T A 1: 6,827,985 Y670* probably null Het
Tjp1 A T 7: 65,337,117 F207I possibly damaging Het
Ugt2b5 A T 5: 87,125,469 L446* probably null Het
Vmn2r105 A T 17: 20,227,730 Y277* probably null Het
Vmn2r11 A T 5: 109,048,934 N557K possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp938 A G 10: 82,227,529 *65Q probably null Het
Other mutations in Trappc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0276:Trappc3 UTSW 4 126273952 missense possibly damaging 0.52
R1104:Trappc3 UTSW 4 126272966 splice site probably benign
R4548:Trappc3 UTSW 4 126272751 missense possibly damaging 0.58
R5847:Trappc3 UTSW 4 126273978 missense probably damaging 1.00
R6057:Trappc3 UTSW 4 126274041 missense probably damaging 1.00
R6264:Trappc3 UTSW 4 126273938 missense probably damaging 0.99
R7087:Trappc3 UTSW 4 126272681 missense probably benign 0.35
R7109:Trappc3 UTSW 4 126273933 missense probably benign 0.15
R7199:Trappc3 UTSW 4 126275152 missense possibly damaging 0.83
R7223:Trappc3 UTSW 4 126275152 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TTTAGCTGCTCGCGCACA -3'
(R):5'- CTCTATTAGCATGGAGGATGGAAATAA -3'

Sequencing Primer
(F):5'- CCCTCTCTCCTTCCCTCCTC -3'
(R):5'- GCATGGAGGATGGAAATAAGGTTAG -3'
Posted On2018-06-06