Incidental Mutation 'R6491:Ugt2b5'
ID522859
Institutional Source Beutler Lab
Gene Symbol Ugt2b5
Ensembl Gene ENSMUSG00000054630
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B5
SynonymsUdpgt-3, m-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6491 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location87124960-87140318 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 87125469 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 446 (L446*)
Ref Sequence ENSEMBL: ENSMUSP00000068282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067790]
Predicted Effect probably null
Transcript: ENSMUST00000067790
AA Change: L446*
SMART Domains Protein: ENSMUSP00000068282
Gene: ENSMUSG00000054630
AA Change: L446*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 527 7.9e-256 PFAM
Pfam:Glyco_tran_28_C 352 449 5.3e-8 PFAM
Meta Mutation Damage Score 0.9653 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,475,972 L431P probably damaging Het
Acad10 A C 5: 121,630,157 W779G probably damaging Het
Acrbp A G 6: 125,051,479 probably benign Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
Ap2a1 A T 7: 44,916,164 I93K probably damaging Het
Arnt T A 3: 95,476,143 M240K probably damaging Het
Ceacam12 A T 7: 18,069,260 K197M probably damaging Het
Cep41 T C 6: 30,656,484 N323S probably benign Het
Dst A G 1: 34,193,012 T2904A probably benign Het
Eml1 G A 12: 108,513,071 probably null Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Irf2bpl A G 12: 86,883,464 V145A probably benign Het
Itga2b T C 11: 102,459,869 probably null Het
Itga8 T C 2: 12,204,776 D466G probably damaging Het
Kdm4c G T 4: 74,373,636 C830F probably damaging Het
Mrps27 T C 13: 99,363,030 S73P probably damaging Het
Mtdh T G 15: 34,116,327 N17K probably damaging Het
Muc3a A G 5: 137,212,128 S9P probably benign Het
Olfr910 A G 9: 38,647,455 L23P probably damaging Het
Oxgr1 T A 14: 120,022,007 I263F probably benign Het
Phc1 A G 6: 122,334,964 Het
Ppp2r5d A G 17: 46,685,583 F388S probably damaging Het
Pxmp4 A G 2: 154,592,163 probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 A G 4: 100,409,912 N270S possibly damaging Het
Slc7a14 T C 3: 31,223,944 Y504C probably damaging Het
Snx9 A G 17: 5,920,162 D391G probably benign Het
St18 T A 1: 6,827,985 Y670* probably null Het
Tjp1 A T 7: 65,337,117 F207I possibly damaging Het
Trappc3 A G 4: 126,275,229 I171V probably benign Het
Vmn2r105 A T 17: 20,227,730 Y277* probably null Het
Vmn2r11 A T 5: 109,048,934 N557K possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp938 A G 10: 82,227,529 *65Q probably null Het
Other mutations in Ugt2b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Ugt2b5 APN 5 87125219 missense probably benign 0.02
IGL00742:Ugt2b5 APN 5 87127814 missense probably damaging 1.00
IGL01527:Ugt2b5 APN 5 87136209 missense possibly damaging 0.71
IGL01530:Ugt2b5 APN 5 87137245 missense probably benign 0.08
IGL01637:Ugt2b5 APN 5 87139900 missense probably benign 0.04
IGL02371:Ugt2b5 APN 5 87127676 critical splice donor site probably null
IGL02993:Ugt2b5 APN 5 87137232 missense probably damaging 1.00
IGL03114:Ugt2b5 APN 5 87128350 missense probably damaging 1.00
R0372:Ugt2b5 UTSW 5 87140258 missense probably benign 0.05
R0568:Ugt2b5 UTSW 5 87137365 critical splice acceptor site probably benign
R0650:Ugt2b5 UTSW 5 87139768 missense probably benign 0.00
R1660:Ugt2b5 UTSW 5 87139618 missense probably benign 0.00
R1907:Ugt2b5 UTSW 5 87139630 missense probably benign 0.19
R1955:Ugt2b5 UTSW 5 87127772 missense probably benign 0.18
R2389:Ugt2b5 UTSW 5 87127682 missense probably damaging 0.98
R2435:Ugt2b5 UTSW 5 87139606 missense probably damaging 0.99
R2919:Ugt2b5 UTSW 5 87125407 missense possibly damaging 0.83
R2920:Ugt2b5 UTSW 5 87125407 missense possibly damaging 0.83
R4342:Ugt2b5 UTSW 5 87139723 missense probably damaging 1.00
R4343:Ugt2b5 UTSW 5 87139723 missense probably damaging 1.00
R4344:Ugt2b5 UTSW 5 87139723 missense probably damaging 1.00
R4355:Ugt2b5 UTSW 5 87139763 nonsense probably null
R4380:Ugt2b5 UTSW 5 87127894 missense probably damaging 1.00
R4789:Ugt2b5 UTSW 5 87139691 missense probably benign 0.14
R4993:Ugt2b5 UTSW 5 87139673 missense probably benign 0.00
R5731:Ugt2b5 UTSW 5 87140252 nonsense probably null
R6035:Ugt2b5 UTSW 5 87139682 missense probably benign 0.09
R6035:Ugt2b5 UTSW 5 87139682 missense probably benign 0.09
R7015:Ugt2b5 UTSW 5 87139796 missense probably damaging 1.00
R7203:Ugt2b5 UTSW 5 87128399 missense possibly damaging 0.72
R7212:Ugt2b5 UTSW 5 87125272 missense probably benign 0.06
R7750:Ugt2b5 UTSW 5 87140249 missense probably benign 0.11
X0004:Ugt2b5 UTSW 5 87128371 nonsense probably null
X0021:Ugt2b5 UTSW 5 87136211 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAGAGGCACTTTACACTAAGGAC -3'
(R):5'- TGCTTCTCTGTAAAATTTGGACCCC -3'

Sequencing Primer
(F):5'- CACTAAGGACTATAGTGGTTGCC -3'
(R):5'- GGTCATAGGACAGCTCAAT -3'
Posted On2018-06-06