Mutagenetix > Incidental Mutations

Incidental Mutation 'R6491:Ugt2b5'

522859

Institutional Source

Beutler Lab

Gene Symbol

Ugt2b5

Ensembl Gene

ENSMUSG00000054630

Gene Name

UDP glucuronosyltransferase 2 family, polypeptide B5

Synonyms

Udpgt-3, m-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R6491 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

87124960-87140318 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 87125469 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 446 (L446*)

Ref Sequence

ENSEMBL: ENSMUSP00000068282 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067790]

Predicted Effect

probably null
Transcript: ENSMUST00000067790
AA Change: L446*

SMART Domains

Protein: ENSMUSP00000068282
Gene: ENSMUSG00000054630
AA Change: L446*

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:UDPGT	24	527	7.9e-256	PFAM
Pfam:Glyco_tran_28_C	352	449	5.3e-8	PFAM

Meta Mutation Damage Score

0.9653

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.5%

Validation Efficiency

100% (35/35)

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	T	C	13: 119,475,972	L431P	probably damaging	Het
Acad10	A	C	5: 121,630,157	W779G	probably damaging	Het
Acrbp	A	G	6: 125,051,479		probably benign	Het
Ank3	G	A	10: 69,991,629	A565T	probably benign	Het
Ap2a1	A	T	7: 44,916,164	I93K	probably damaging	Het
Arnt	T	A	3: 95,476,143	M240K	probably damaging	Het
Ceacam12	A	T	7: 18,069,260	K197M	probably damaging	Het
Cep41	T	C	6: 30,656,484	N323S	probably benign	Het
Dst	A	G	1: 34,193,012	T2904A	probably benign	Het
Eml1	G	A	12: 108,513,071		probably null	Het
Fbln2	A	G	6: 91,259,750	N749S	possibly damaging	Het
Irf2bpl	A	G	12: 86,883,464	V145A	probably benign	Het
Itga2b	T	C	11: 102,459,869		probably null	Het
Itga8	T	C	2: 12,204,776	D466G	probably damaging	Het
Kdm4c	G	T	4: 74,373,636	C830F	probably damaging	Het
Mrps27	T	C	13: 99,363,030	S73P	probably damaging	Het
Mtdh	T	G	15: 34,116,327	N17K	probably damaging	Het
Muc3a	A	G	5: 137,212,128	S9P	probably benign	Het
Olfr910	A	G	9: 38,647,455	L23P	probably damaging	Het
Oxgr1	T	A	14: 120,022,007	I263F	probably benign	Het
Phc1	A	G	6: 122,334,964			Het
Ppp2r5d	A	G	17: 46,685,583	F388S	probably damaging	Het
Pxmp4	A	G	2: 154,592,163		probably null	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Ror1	A	G	4: 100,409,912	N270S	possibly damaging	Het
Slc7a14	T	C	3: 31,223,944	Y504C	probably damaging	Het
Snx9	A	G	17: 5,920,162	D391G	probably benign	Het
St18	T	A	1: 6,827,985	Y670*	probably null	Het
Tjp1	A	T	7: 65,337,117	F207I	possibly damaging	Het
Trappc3	A	G	4: 126,275,229	I171V	probably benign	Het
Vmn2r105	A	T	17: 20,227,730	Y277*	probably null	Het
Vmn2r11	A	T	5: 109,048,934	N557K	possibly damaging	Het
Yod1	G	A	1: 130,717,538	G19S	probably damaging	Het
Zfp938	A	G	10: 82,227,529	*65Q	probably null	Het

Other mutations in Ugt2b5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00702:Ugt2b5	APN	5	87125219	missense	probably benign	0.02
IGL00742:Ugt2b5	APN	5	87127814	missense	probably damaging	1.00
IGL01527:Ugt2b5	APN	5	87136209	missense	possibly damaging	0.71
IGL01530:Ugt2b5	APN	5	87137245	missense	probably benign	0.08
IGL01637:Ugt2b5	APN	5	87139900	missense	probably benign	0.04
IGL02371:Ugt2b5	APN	5	87127676	critical splice donor site	probably null
IGL02993:Ugt2b5	APN	5	87137232	missense	probably damaging	1.00
IGL03114:Ugt2b5	APN	5	87128350	missense	probably damaging	1.00
R0372:Ugt2b5	UTSW	5	87140258	missense	probably benign	0.05
R0568:Ugt2b5	UTSW	5	87137365	critical splice acceptor site	probably benign
R0650:Ugt2b5	UTSW	5	87139768	missense	probably benign	0.00
R1660:Ugt2b5	UTSW	5	87139618	missense	probably benign	0.00
R1907:Ugt2b5	UTSW	5	87139630	missense	probably benign	0.19
R1955:Ugt2b5	UTSW	5	87127772	missense	probably benign	0.18
R2389:Ugt2b5	UTSW	5	87127682	missense	probably damaging	0.98
R2435:Ugt2b5	UTSW	5	87139606	missense	probably damaging	0.99
R2919:Ugt2b5	UTSW	5	87125407	missense	possibly damaging	0.83
R2920:Ugt2b5	UTSW	5	87125407	missense	possibly damaging	0.83
R4342:Ugt2b5	UTSW	5	87139723	missense	probably damaging	1.00
R4343:Ugt2b5	UTSW	5	87139723	missense	probably damaging	1.00
R4344:Ugt2b5	UTSW	5	87139723	missense	probably damaging	1.00
R4355:Ugt2b5	UTSW	5	87139763	nonsense	probably null
R4380:Ugt2b5	UTSW	5	87127894	missense	probably damaging	1.00
R4789:Ugt2b5	UTSW	5	87139691	missense	probably benign	0.14
R4993:Ugt2b5	UTSW	5	87139673	missense	probably benign	0.00
R5731:Ugt2b5	UTSW	5	87140252	nonsense	probably null
R6035:Ugt2b5	UTSW	5	87139682	missense	probably benign	0.09
R6035:Ugt2b5	UTSW	5	87139682	missense	probably benign	0.09
R7015:Ugt2b5	UTSW	5	87139796	missense	probably damaging	1.00
R7203:Ugt2b5	UTSW	5	87128399	missense	possibly damaging	0.72
R7212:Ugt2b5	UTSW	5	87125272	missense	probably benign	0.06
R7750:Ugt2b5	UTSW	5	87140249	missense	probably benign	0.11
X0004:Ugt2b5	UTSW	5	87128371	nonsense	probably null
X0021:Ugt2b5	UTSW	5	87136211	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- AAGAGGCACTTTACACTAAGGAC -3'
(R):5'- TGCTTCTCTGTAAAATTTGGACCCC -3'

Sequencing Primer
(F):5'- CACTAAGGACTATAGTGGTTGCC -3'
(R):5'- GGTCATAGGACAGCTCAAT -3'

Posted On

2018-06-06