Incidental Mutation 'R6493:Taar6'
ID 522862
Institutional Source Beutler Lab
Gene Symbol Taar6
Ensembl Gene ENSMUSG00000045111
Gene Name trace amine-associated receptor 6
Synonyms LOC215855
MMRRC Submission 044625-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.179) question?
Stock # R6493 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 23860507-23861544 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23861021 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 175 (D175G)
Ref Sequence ENSEMBL: ENSMUSP00000097603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057080]
AlphaFold Q5QD13
Predicted Effect probably benign
Transcript: ENSMUST00000057080
AA Change: D175G

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097603
Gene: ENSMUSG00000045111
AA Change: D175G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 326 5.5e-13 PFAM
Pfam:7tm_1 49 311 5.9e-58 PFAM
Meta Mutation Damage Score 0.1824 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-transmembrane G-protein-coupled receptor that likely functions as a receptor for endogenous trace amines. Mutations in this gene may be associated with schizophrenia.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,184,704 (GRCm39) H934L probably benign Het
Abcb1b G A 5: 8,874,698 (GRCm39) D453N probably damaging Het
Ampd3 A G 7: 110,395,018 (GRCm39) probably null Het
Axdnd1 A T 1: 156,208,383 (GRCm39) I485N probably damaging Het
Bscl2 A G 19: 8,817,138 (GRCm39) D22G probably damaging Het
Ccdc96 A G 5: 36,643,596 (GRCm39) E534G probably damaging Het
Cdc42bpg G T 19: 6,368,485 (GRCm39) G1061V probably damaging Het
Cers3 T C 7: 66,393,468 (GRCm39) Y26H probably benign Het
Chd1l G A 3: 97,494,483 (GRCm39) A399V probably damaging Het
Clca4a T A 3: 144,663,059 (GRCm39) T597S probably benign Het
Daxx T A 17: 34,131,345 (GRCm39) probably null Het
Egf T C 3: 129,512,737 (GRCm39) probably benign Het
Eps15 A G 4: 109,226,145 (GRCm39) D629G probably damaging Het
Fancm G A 12: 65,144,262 (GRCm39) A575T probably benign Het
Fat4 G A 3: 38,945,036 (GRCm39) D1310N probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Grxcr2 G A 18: 42,131,766 (GRCm39) P101L possibly damaging Het
Hsd17b12 A T 2: 93,874,228 (GRCm39) I225N probably damaging Het
Kcnj8 T C 6: 142,511,773 (GRCm39) Y278C probably damaging Het
Lama3 G A 18: 12,615,205 (GRCm39) probably null Het
Lax1 C T 1: 133,607,530 (GRCm39) D404N probably benign Het
Lipg T C 18: 75,081,095 (GRCm39) K329E probably damaging Het
Lysmd2 T G 9: 75,542,984 (GRCm39) L197R probably damaging Het
Maneal A T 4: 124,750,964 (GRCm39) I264N probably damaging Het
Myh4 A G 11: 67,149,455 (GRCm39) N1729S probably benign Het
Myl2 A G 5: 122,244,791 (GRCm39) N154D possibly damaging Het
Nlrp9c T A 7: 26,081,812 (GRCm39) D638V probably damaging Het
Notch1 T C 2: 26,362,110 (GRCm39) H74R unknown Het
Olfml3 A T 3: 103,643,523 (GRCm39) V286D possibly damaging Het
Or14c46 T G 7: 85,918,090 (GRCm39) K302N probably benign Het
Or4b12 G A 2: 90,096,052 (GRCm39) H241Y probably damaging Het
Or51a25 G T 7: 102,373,287 (GRCm39) R137S possibly damaging Het
Or51f23c-ps1 A G 7: 102,431,603 (GRCm39) K307E probably benign Het
Or8k41 T C 2: 86,313,565 (GRCm39) I174V possibly damaging Het
Parn A C 16: 13,474,789 (GRCm39) F127V probably damaging Het
Pcdhac2 T C 18: 37,277,758 (GRCm39) V246A probably damaging Het
Plin2 G A 4: 86,580,224 (GRCm39) T90I possibly damaging Het
Podxl C T 6: 31,501,981 (GRCm39) C326Y probably damaging Het
Pramel46 A G 5: 95,418,684 (GRCm39) L104P probably damaging Het
Prl8a8 T A 13: 27,691,335 (GRCm39) K223* probably null Het
Ptprh T G 7: 4,583,989 (GRCm39) E201A possibly damaging Het
Rtn1 A C 12: 72,355,103 (GRCm39) V281G probably damaging Het
Scaf8 T C 17: 3,221,394 (GRCm39) S294P unknown Het
Shroom3 C A 5: 93,089,420 (GRCm39) N723K probably benign Het
Spata22 T C 11: 73,244,572 (GRCm39) *312R probably null Het
Stx7 T C 10: 24,060,969 (GRCm39) probably null Het
Tbccd1 A C 16: 22,641,216 (GRCm39) L387R probably damaging Het
Tecpr1 T C 5: 144,146,792 (GRCm39) M525V probably benign Het
Tex10 A T 4: 48,436,450 (GRCm39) I756N probably damaging Het
Tfap2d G C 1: 19,174,702 (GRCm39) G52R probably benign Het
Ttn T C 2: 76,572,341 (GRCm39) E24438G probably damaging Het
Tut4 A G 4: 108,384,002 (GRCm39) K1053R probably damaging Het
Wdpcp C T 11: 21,661,631 (GRCm39) T301I possibly damaging Het
Zbtb1 C T 12: 76,433,247 (GRCm39) T411I probably benign Het
Zzef1 G A 11: 72,804,129 (GRCm39) G2624R probably benign Het
Other mutations in Taar6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Taar6 APN 10 23,861,406 (GRCm39) missense probably benign 0.15
IGL00918:Taar6 APN 10 23,861,480 (GRCm39) missense probably damaging 1.00
IGL01060:Taar6 APN 10 23,860,970 (GRCm39) missense probably benign
IGL02608:Taar6 APN 10 23,861,081 (GRCm39) missense probably benign 0.01
R0042:Taar6 UTSW 10 23,861,021 (GRCm39) missense probably benign 0.36
R0042:Taar6 UTSW 10 23,861,021 (GRCm39) missense probably benign 0.36
R0360:Taar6 UTSW 10 23,861,046 (GRCm39) missense probably benign 0.01
R0364:Taar6 UTSW 10 23,861,046 (GRCm39) missense probably benign 0.01
R0746:Taar6 UTSW 10 23,861,258 (GRCm39) missense probably benign 0.43
R1637:Taar6 UTSW 10 23,861,079 (GRCm39) missense probably benign 0.12
R4893:Taar6 UTSW 10 23,861,298 (GRCm39) missense probably benign
R4944:Taar6 UTSW 10 23,860,613 (GRCm39) missense probably damaging 1.00
R4951:Taar6 UTSW 10 23,861,106 (GRCm39) missense probably benign 0.09
R5173:Taar6 UTSW 10 23,861,250 (GRCm39) missense probably damaging 1.00
R5181:Taar6 UTSW 10 23,860,683 (GRCm39) missense possibly damaging 0.76
R5919:Taar6 UTSW 10 23,861,168 (GRCm39) missense probably damaging 1.00
R5988:Taar6 UTSW 10 23,861,154 (GRCm39) missense probably damaging 0.98
R6327:Taar6 UTSW 10 23,861,177 (GRCm39) missense probably damaging 1.00
R7595:Taar6 UTSW 10 23,860,968 (GRCm39) missense probably benign
R7802:Taar6 UTSW 10 23,861,151 (GRCm39) missense probably benign 0.02
R8053:Taar6 UTSW 10 23,861,144 (GRCm39) missense possibly damaging 0.59
R8506:Taar6 UTSW 10 23,861,529 (GRCm39) missense probably benign 0.01
R9169:Taar6 UTSW 10 23,861,273 (GRCm39) missense probably damaging 0.99
R9272:Taar6 UTSW 10 23,860,903 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGATGATTCTGTTTTGCTCCC -3'
(R):5'- CGAGAGCTGCTGGTACTTTG -3'

Sequencing Primer
(F):5'- GATTCTGTTTTGCTCCCAATATTTTC -3'
(R):5'- GGTAGAAGTTTCTGCACTTTCCACAC -3'
Posted On 2018-06-06