Incidental Mutation 'R6491:Acad10'
ID522863
Institutional Source Beutler Lab
Gene Symbol Acad10
Ensembl Gene ENSMUSG00000029456
Gene Nameacyl-Coenzyme A dehydrogenase family, member 10
Synonyms2410021P16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6491 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location121621026-121660514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 121630157 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 779 (W779G)
Ref Sequence ENSEMBL: ENSMUSP00000107400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031412] [ENSMUST00000111770]
Predicted Effect probably damaging
Transcript: ENSMUST00000031412
AA Change: W779G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031412
Gene: ENSMUSG00000029456
AA Change: W779G

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 1.6e-14 PFAM
Pfam:Hydrolase 88 225 5e-8 PFAM
Pfam:APH 287 531 1.8e-52 PFAM
Pfam:Acyl-CoA_dh_N 660 787 1.7e-15 PFAM
Pfam:Acyl-CoA_dh_M 791 892 2.7e-20 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 1.1e-35 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 6.4e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111770
AA Change: W779G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107400
Gene: ENSMUSG00000029456
AA Change: W779G

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 2.3e-14 PFAM
Pfam:APH 287 523 3.2e-50 PFAM
Pfam:EcKinase 390 504 5.2e-8 PFAM
Pfam:Acyl-CoA_dh_N 660 787 3.4e-14 PFAM
Pfam:Acyl-CoA_dh_M 791 845 2.7e-13 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 9.4e-36 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 1.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143187
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes (ACADs), which participate in the beta-oxidation of fatty acids in mitochondria. The encoded enzyme contains a hydrolase domain at the N-terminal portion, a serine/threonine protein kinase catlytic domain in the central region, and a conserved ACAD domain at the C-terminus. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,475,972 L431P probably damaging Het
Acrbp A G 6: 125,051,479 probably benign Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
Ap2a1 A T 7: 44,916,164 I93K probably damaging Het
Arnt T A 3: 95,476,143 M240K probably damaging Het
Ceacam12 A T 7: 18,069,260 K197M probably damaging Het
Cep41 T C 6: 30,656,484 N323S probably benign Het
Dst A G 1: 34,193,012 T2904A probably benign Het
Eml1 G A 12: 108,513,071 probably null Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Irf2bpl A G 12: 86,883,464 V145A probably benign Het
Itga2b T C 11: 102,459,869 probably null Het
Itga8 T C 2: 12,204,776 D466G probably damaging Het
Kdm4c G T 4: 74,373,636 C830F probably damaging Het
Mrps27 T C 13: 99,363,030 S73P probably damaging Het
Mtdh T G 15: 34,116,327 N17K probably damaging Het
Muc3a A G 5: 137,212,128 S9P probably benign Het
Olfr910 A G 9: 38,647,455 L23P probably damaging Het
Oxgr1 T A 14: 120,022,007 I263F probably benign Het
Phc1 A G 6: 122,334,964 Het
Ppp2r5d A G 17: 46,685,583 F388S probably damaging Het
Pxmp4 A G 2: 154,592,163 probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 A G 4: 100,409,912 N270S possibly damaging Het
Slc7a14 T C 3: 31,223,944 Y504C probably damaging Het
Snx9 A G 17: 5,920,162 D391G probably benign Het
St18 T A 1: 6,827,985 Y670* probably null Het
Tjp1 A T 7: 65,337,117 F207I possibly damaging Het
Trappc3 A G 4: 126,275,229 I171V probably benign Het
Ugt2b5 A T 5: 87,125,469 L446* probably null Het
Vmn2r105 A T 17: 20,227,730 Y277* probably null Het
Vmn2r11 A T 5: 109,048,934 N557K possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp938 A G 10: 82,227,529 *65Q probably null Het
Other mutations in Acad10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02379:Acad10 APN 5 121622043 missense probably damaging 1.00
IGL02469:Acad10 APN 5 121645459 missense probably damaging 1.00
IGL02526:Acad10 APN 5 121646860 missense probably damaging 0.99
IGL02623:Acad10 APN 5 121629930 missense possibly damaging 0.94
IGL02643:Acad10 APN 5 121631570 missense probably benign
IGL02685:Acad10 APN 5 121632609 missense probably benign
IGL03139:Acad10 APN 5 121626082 missense probably benign
IGL03267:Acad10 APN 5 121637349 missense probably benign 0.34
P0026:Acad10 UTSW 5 121637352 missense probably damaging 1.00
R0099:Acad10 UTSW 5 121621290 missense probably damaging 1.00
R0453:Acad10 UTSW 5 121627382 nonsense probably null
R1051:Acad10 UTSW 5 121626080 missense probably damaging 0.97
R1052:Acad10 UTSW 5 121649541 missense possibly damaging 0.65
R1116:Acad10 UTSW 5 121630751 missense probably damaging 1.00
R1548:Acad10 UTSW 5 121626040 splice site probably benign
R1548:Acad10 UTSW 5 121626041 splice site probably benign
R1571:Acad10 UTSW 5 121621348 missense probably damaging 0.99
R1592:Acad10 UTSW 5 121645381 missense probably damaging 0.99
R1741:Acad10 UTSW 5 121647836 missense probably damaging 1.00
R1789:Acad10 UTSW 5 121631393 missense possibly damaging 0.67
R1974:Acad10 UTSW 5 121626185 missense possibly damaging 0.95
R2007:Acad10 UTSW 5 121634751 missense probably damaging 1.00
R2085:Acad10 UTSW 5 121649460 missense possibly damaging 0.79
R2351:Acad10 UTSW 5 121629927 missense probably benign 0.23
R2511:Acad10 UTSW 5 121631567 missense probably benign 0.02
R2570:Acad10 UTSW 5 121630204 missense probably damaging 1.00
R3824:Acad10 UTSW 5 121622818 missense probably benign
R3846:Acad10 UTSW 5 121634686 missense probably benign 0.19
R4106:Acad10 UTSW 5 121631464 missense probably damaging 0.98
R4107:Acad10 UTSW 5 121631464 missense probably damaging 0.98
R4108:Acad10 UTSW 5 121631464 missense probably damaging 0.98
R5569:Acad10 UTSW 5 121626080 missense probably damaging 0.97
R5704:Acad10 UTSW 5 121631543 missense probably benign 0.03
R5845:Acad10 UTSW 5 121626083 missense probably benign
R5990:Acad10 UTSW 5 121645405 missense probably damaging 1.00
R6019:Acad10 UTSW 5 121634801 missense possibly damaging 0.88
R6145:Acad10 UTSW 5 121622033 missense probably damaging 0.97
R6384:Acad10 UTSW 5 121652003 missense probably benign 0.43
R6608:Acad10 UTSW 5 121632492 missense probably benign 0.02
R6941:Acad10 UTSW 5 121649357 missense probably damaging 1.00
R7221:Acad10 UTSW 5 121630210 missense probably damaging 1.00
R7283:Acad10 UTSW 5 121649475 missense possibly damaging 0.79
R7355:Acad10 UTSW 5 121630717 nonsense probably null
R7483:Acad10 UTSW 5 121656012 critical splice donor site probably null
R7553:Acad10 UTSW 5 121639255 missense probably damaging 1.00
R7721:Acad10 UTSW 5 121646866 splice site probably null
R8075:Acad10 UTSW 5 121652085 missense probably benign 0.00
X0061:Acad10 UTSW 5 121622813 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTTTGATGGAAGCCTCG -3'
(R):5'- AGGAAACGCTTTCATGAGTTGTC -3'

Sequencing Primer
(F):5'- CTCGATGTTAGAGGCATCTGAG -3'
(R):5'- AAACGCTTTCATGAGTTGTCAGAGTG -3'
Posted On2018-06-06