Incidental Mutation 'R6491:Muc3a'
ID522865
Institutional Source Beutler Lab
Gene Symbol Muc3a
Ensembl Gene ENSMUSG00000094840
Gene Namemucin 3A, cell surface associated
SynonymsA630081J09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6491 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location137208813-137212389 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137212128 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 9 (S9P)
Ref Sequence ENSEMBL: ENSMUSP00000136061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179412]
Predicted Effect probably benign
Transcript: ENSMUST00000179412
AA Change: S9P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000136061
Gene: ENSMUSG00000094840
AA Change: S9P

DomainStartEndE-ValueType
Blast:EGF_like 54 95 1e-22 BLAST
transmembrane domain 103 125 N/A INTRINSIC
low complexity region 198 218 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000196391
AA Change: S7P
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mucin genes encode epithelial glycoproteins, some of which are secreted and some membrane bound. Each of the genes contains at least one large domain of tandemly repeated sequence that encodes the peptide sequence rich in serine and/or threonine residues, which carries most of the O-linked glycosylation (Gendler and Spicer, 1995 [PubMed 7778880]).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,475,972 L431P probably damaging Het
Acad10 A C 5: 121,630,157 W779G probably damaging Het
Acrbp A G 6: 125,051,479 probably benign Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
Ap2a1 A T 7: 44,916,164 I93K probably damaging Het
Arnt T A 3: 95,476,143 M240K probably damaging Het
Ceacam12 A T 7: 18,069,260 K197M probably damaging Het
Cep41 T C 6: 30,656,484 N323S probably benign Het
Dst A G 1: 34,193,012 T2904A probably benign Het
Eml1 G A 12: 108,513,071 probably null Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Irf2bpl A G 12: 86,883,464 V145A probably benign Het
Itga2b T C 11: 102,459,869 probably null Het
Itga8 T C 2: 12,204,776 D466G probably damaging Het
Kdm4c G T 4: 74,373,636 C830F probably damaging Het
Mrps27 T C 13: 99,363,030 S73P probably damaging Het
Mtdh T G 15: 34,116,327 N17K probably damaging Het
Olfr910 A G 9: 38,647,455 L23P probably damaging Het
Oxgr1 T A 14: 120,022,007 I263F probably benign Het
Phc1 A G 6: 122,334,964 Het
Ppp2r5d A G 17: 46,685,583 F388S probably damaging Het
Pxmp4 A G 2: 154,592,163 probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 A G 4: 100,409,912 N270S possibly damaging Het
Slc7a14 T C 3: 31,223,944 Y504C probably damaging Het
Snx9 A G 17: 5,920,162 D391G probably benign Het
St18 T A 1: 6,827,985 Y670* probably null Het
Tjp1 A T 7: 65,337,117 F207I possibly damaging Het
Trappc3 A G 4: 126,275,229 I171V probably benign Het
Ugt2b5 A T 5: 87,125,469 L446* probably null Het
Vmn2r105 A T 17: 20,227,730 Y277* probably null Het
Vmn2r11 A T 5: 109,048,934 N557K possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp938 A G 10: 82,227,529 *65Q probably null Het
Other mutations in Muc3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1500:Muc3a UTSW 5 137210501 splice site probably benign
R1536:Muc3a UTSW 5 137210081 missense unknown
R5076:Muc3a UTSW 5 137210540 missense probably damaging 0.99
R5356:Muc3a UTSW 5 137210564 missense probably benign 0.33
R6134:Muc3a UTSW 5 137210122 missense probably damaging 0.99
R7524:Muc3a UTSW 5 137210563 missense probably benign 0.08
R8181:Muc3a UTSW 5 137210078 missense unknown
Predicted Primers PCR Primer
(F):5'- GGCAGGAAGGTACAATTCACCC -3'
(R):5'- TCTCTGGCCTATGCTAGCTCAG -3'

Sequencing Primer
(F):5'- CCACAACAGTGGCTTCTCC -3'
(R):5'- CTATGCTAGCTCAGTCAGGGAAC -3'
Posted On2018-06-06