Incidental Mutation 'R6491:Cep41'
ID522867
Institutional Source Beutler Lab
Gene Symbol Cep41
Ensembl Gene ENSMUSG00000029790
Gene Namecentrosomal protein 41
SynonymsTsga14, 2810431D15Rik, 1700017E11Rik, Cep41
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6491 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location30653457-30693749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30656484 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 323 (N323S)
Ref Sequence ENSEMBL: ENSMUSP00000031810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031810] [ENSMUST00000115131] [ENSMUST00000140211] [ENSMUST00000140252]
Predicted Effect probably benign
Transcript: ENSMUST00000031810
AA Change: N323S

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000031810
Gene: ENSMUSG00000029790
AA Change: N323S

DomainStartEndE-ValueType
RHOD 151 263 9.88e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115131
SMART Domains Protein: ENSMUSP00000110784
Gene: ENSMUSG00000029790

DomainStartEndE-ValueType
RHOD 151 263 1.62e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132763
Predicted Effect probably benign
Transcript: ENSMUST00000140211
Predicted Effect probably benign
Transcript: ENSMUST00000140252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153107
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: This gene encodes a centrosomal protein which may be required for tubulin glutamylation in cilia during ciliogenesis. Mutations in a similar gene in human have been associated with Joubert Syndrome 15, an autosomal recessive ciliopathy and neurological disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous disruption of this gene causes an abnormal gait, increased thermal nociceptive threshold, and alterations in fertility/fecundity and eye morphology. Some embryos homozygous for a gene trapped allele die at E10-E12 exhibiting turning failure, dilated pericardial sacs, and brain anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,475,972 L431P probably damaging Het
Acad10 A C 5: 121,630,157 W779G probably damaging Het
Acrbp A G 6: 125,051,479 probably benign Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
Ap2a1 A T 7: 44,916,164 I93K probably damaging Het
Arnt T A 3: 95,476,143 M240K probably damaging Het
Ceacam12 A T 7: 18,069,260 K197M probably damaging Het
Dst A G 1: 34,193,012 T2904A probably benign Het
Eml1 G A 12: 108,513,071 probably null Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Irf2bpl A G 12: 86,883,464 V145A probably benign Het
Itga2b T C 11: 102,459,869 probably null Het
Itga8 T C 2: 12,204,776 D466G probably damaging Het
Kdm4c G T 4: 74,373,636 C830F probably damaging Het
Mrps27 T C 13: 99,363,030 S73P probably damaging Het
Mtdh T G 15: 34,116,327 N17K probably damaging Het
Muc3a A G 5: 137,212,128 S9P probably benign Het
Olfr910 A G 9: 38,647,455 L23P probably damaging Het
Oxgr1 T A 14: 120,022,007 I263F probably benign Het
Phc1 A G 6: 122,334,964 Het
Ppp2r5d A G 17: 46,685,583 F388S probably damaging Het
Pxmp4 A G 2: 154,592,163 probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 A G 4: 100,409,912 N270S possibly damaging Het
Slc7a14 T C 3: 31,223,944 Y504C probably damaging Het
Snx9 A G 17: 5,920,162 D391G probably benign Het
St18 T A 1: 6,827,985 Y670* probably null Het
Tjp1 A T 7: 65,337,117 F207I possibly damaging Het
Trappc3 A G 4: 126,275,229 I171V probably benign Het
Ugt2b5 A T 5: 87,125,469 L446* probably null Het
Vmn2r105 A T 17: 20,227,730 Y277* probably null Het
Vmn2r11 A T 5: 109,048,934 N557K possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp938 A G 10: 82,227,529 *65Q probably null Het
Other mutations in Cep41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Cep41 APN 6 30660967 missense probably benign 0.29
IGL02640:Cep41 APN 6 30658868 missense probably benign 0.00
PIT4480001:Cep41 UTSW 6 30658413 missense probably damaging 1.00
R0627:Cep41 UTSW 6 30656631 missense probably damaging 1.00
R1416:Cep41 UTSW 6 30657357 missense probably damaging 0.97
R1856:Cep41 UTSW 6 30661006 missense probably damaging 0.96
R2265:Cep41 UTSW 6 30660916 missense possibly damaging 0.50
R3881:Cep41 UTSW 6 30658398 missense probably damaging 1.00
R4488:Cep41 UTSW 6 30655689 utr 3 prime probably benign
R4678:Cep41 UTSW 6 30671319 splice site probably null
R4758:Cep41 UTSW 6 30671369 splice site probably benign
R7344:Cep41 UTSW 6 30693656 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGTCCTCTCTGCCTAAGACAC -3'
(R):5'- CAGAAGGACTGGTCACTGGTTC -3'

Sequencing Primer
(F):5'- ACACAGGCTCCCCATGCTTG -3'
(R):5'- GACTGGTCACTGGTTCCCTGC -3'
Posted On2018-06-06