Incidental Mutation 'R6491:Acrbp'
ID522871
Institutional Source Beutler Lab
Gene Symbol Acrbp
Ensembl Gene ENSMUSG00000072770
Gene Nameproacrosin binding protein
Synonymssp32, OY-TES-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R6491 (G1)
Quality Score184.009
Status Validated
Chromosome6
Chromosomal Location125049689-125063267 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 125051479 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032480] [ENSMUST00000032481] [ENSMUST00000088294] [ENSMUST00000112413] [ENSMUST00000112414] [ENSMUST00000112417] [ENSMUST00000140131]
Predicted Effect probably benign
Transcript: ENSMUST00000032480
SMART Domains Protein: ENSMUSP00000032480
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 5.5e-35 PFAM
low complexity region 118 131 N/A INTRINSIC
PHD 197 242 3.67e-12 SMART
Predicted Effect unknown
Transcript: ENSMUST00000032481
AA Change: N158S
SMART Domains Protein: ENSMUSP00000032481
Gene: ENSMUSG00000072770
AA Change: N158S

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 140 4.8e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088294
SMART Domains Protein: ENSMUSP00000085632
Gene: ENSMUSG00000072770

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 239 1.6e-139 PFAM
KAZAL 466 506 1.42e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112412
SMART Domains Protein: ENSMUSP00000108031
Gene: ENSMUSG00000072770

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 87 6.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112413
SMART Domains Protein: ENSMUSP00000108032
Gene: ENSMUSG00000072770

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 169 6.2e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112414
SMART Domains Protein: ENSMUSP00000108033
Gene: ENSMUSG00000072770

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 239 1.9e-138 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112417
SMART Domains Protein: ENSMUSP00000108036
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 6.5e-35 PFAM
low complexity region 118 126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133695
Predicted Effect probably benign
Transcript: ENSMUST00000140131
SMART Domains Protein: ENSMUSP00000121519
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 6 107 2.1e-35 PFAM
low complexity region 114 139 N/A INTRINSIC
PHD 198 243 3.67e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140883
SMART Domains Protein: ENSMUSP00000118561
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 1e-34 PFAM
low complexity region 118 131 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151125
SMART Domains Protein: ENSMUSP00000119709
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 1.4e-34 PFAM
low complexity region 118 131 N/A INTRINSIC
PDB:1WEU|A 167 216 3e-32 PDB
SCOP:d1fp0a1 190 216 2e-3 SMART
Blast:PHD 197 215 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205110
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to proacrosin binding protein sp32 precursor found in mouse, guinea pig, and pig. This protein is located in the sperm acrosome and is thought to function as a binding protein to proacrosin for packaging and condensation of the acrosin zymogen in the acrosomal matrix. This protein is a member of the cancer/testis family of antigens and it is found to be immunogenic. In normal tissues, this mRNA is expressed only in testis, whereas it is detected in a range of different tumor types such as bladder, breast, lung, liver, and colon. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in delayed fertilization due to a delay in sperm penetration of the zona pellucida. Homozygous sperm also show reduced fertilization rates of oocytes with a thick or hardened zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,475,972 L431P probably damaging Het
Acad10 A C 5: 121,630,157 W779G probably damaging Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
Ap2a1 A T 7: 44,916,164 I93K probably damaging Het
Arnt T A 3: 95,476,143 M240K probably damaging Het
Ceacam12 A T 7: 18,069,260 K197M probably damaging Het
Cep41 T C 6: 30,656,484 N323S probably benign Het
Dst A G 1: 34,193,012 T2904A probably benign Het
Eml1 G A 12: 108,513,071 probably null Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Irf2bpl A G 12: 86,883,464 V145A probably benign Het
Itga2b T C 11: 102,459,869 probably null Het
Itga8 T C 2: 12,204,776 D466G probably damaging Het
Kdm4c G T 4: 74,373,636 C830F probably damaging Het
Mrps27 T C 13: 99,363,030 S73P probably damaging Het
Mtdh T G 15: 34,116,327 N17K probably damaging Het
Muc3a A G 5: 137,212,128 S9P probably benign Het
Olfr910 A G 9: 38,647,455 L23P probably damaging Het
Oxgr1 T A 14: 120,022,007 I263F probably benign Het
Phc1 A G 6: 122,334,964 Het
Ppp2r5d A G 17: 46,685,583 F388S probably damaging Het
Pxmp4 A G 2: 154,592,163 probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 A G 4: 100,409,912 N270S possibly damaging Het
Slc7a14 T C 3: 31,223,944 Y504C probably damaging Het
Snx9 A G 17: 5,920,162 D391G probably benign Het
St18 T A 1: 6,827,985 Y670* probably null Het
Tjp1 A T 7: 65,337,117 F207I possibly damaging Het
Trappc3 A G 4: 126,275,229 I171V probably benign Het
Ugt2b5 A T 5: 87,125,469 L446* probably null Het
Vmn2r105 A T 17: 20,227,730 Y277* probably null Het
Vmn2r11 A T 5: 109,048,934 N557K possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp938 A G 10: 82,227,529 *65Q probably null Het
Other mutations in Acrbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Acrbp APN 6 125050514 missense probably damaging 1.00
IGL01656:Acrbp APN 6 125053712 missense possibly damaging 0.88
IGL02095:Acrbp APN 6 125053956 nonsense probably null
IGL02186:Acrbp APN 6 125054810 splice site probably null
IGL02473:Acrbp APN 6 125054698 missense probably benign
IGL02831:Acrbp APN 6 125061249 missense possibly damaging 0.89
IGL03110:Acrbp APN 6 125062473 missense probably damaging 0.99
R0071:Acrbp UTSW 6 125050952 unclassified probably benign
R0071:Acrbp UTSW 6 125050952 unclassified probably benign
R0279:Acrbp UTSW 6 125053954 critical splice donor site probably null
R0483:Acrbp UTSW 6 125054796 missense possibly damaging 0.61
R1017:Acrbp UTSW 6 125061260 splice site probably benign
R1486:Acrbp UTSW 6 125050622 missense probably damaging 1.00
R4679:Acrbp UTSW 6 125060918 missense probably damaging 0.96
R4898:Acrbp UTSW 6 125050538 missense probably damaging 0.97
R4987:Acrbp UTSW 6 125053762 missense probably benign 0.23
R5249:Acrbp UTSW 6 125060922 missense probably damaging 0.98
R5458:Acrbp UTSW 6 125050050 unclassified probably benign
R5579:Acrbp UTSW 6 125061099 missense probably benign 0.00
R7643:Acrbp UTSW 6 125053832 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCAGCAGAAGTTCCTCCCAC -3'
(R):5'- CCAGGGCCTCATGCATAGAATG -3'

Sequencing Primer
(F):5'- GAAGTTCCTCCCACTTCCATGAC -3'
(R):5'- CTGTACTCCCAGTCCAAA -3'
Posted On2018-06-06