Incidental Mutation 'R6493:Gm11595'
ID 522874
Institutional Source Beutler Lab
Gene Symbol Gm11595
Ensembl Gene ENSMUSG00000078668
Gene Name predicted gene 11595
Synonyms
MMRRC Submission 044625-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R6493 (G1)
Quality Score 185.009
Status Not validated
Chromosome 11
Chromosomal Location 99662540-99663739 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 99663381 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 100 (R100C)
Ref Sequence ENSEMBL: ENSMUSP00000103064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107440]
AlphaFold B1AQA7
Predicted Effect unknown
Transcript: ENSMUST00000107440
AA Change: R100C
SMART Domains Protein: ENSMUSP00000103064
Gene: ENSMUSG00000078668
AA Change: R100C

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 47 7.5e-9 PFAM
Pfam:Keratin_B2_2 14 58 2.8e-13 PFAM
Pfam:Keratin_B2_2 29 73 1.2e-13 PFAM
Pfam:Keratin_B2_2 72 112 2.3e-12 PFAM
Pfam:Keratin_B2_2 107 152 4.6e-14 PFAM
Pfam:Keratin_B2_2 118 162 1.1e-13 PFAM
Pfam:Keratin_B2_2 143 187 3.5e-10 PFAM
Pfam:Keratin_B2_2 168 212 5.6e-13 PFAM
Pfam:Keratin_B2_2 178 222 2.4e-12 PFAM
Pfam:Keratin_B2_2 208 257 1.6e-11 PFAM
Pfam:Keratin_B2_2 223 267 4e-14 PFAM
Pfam:Keratin_B2_2 248 289 9e-9 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,184,704 (GRCm39) H934L probably benign Het
Abcb1b G A 5: 8,874,698 (GRCm39) D453N probably damaging Het
Ampd3 A G 7: 110,395,018 (GRCm39) probably null Het
Axdnd1 A T 1: 156,208,383 (GRCm39) I485N probably damaging Het
Bscl2 A G 19: 8,817,138 (GRCm39) D22G probably damaging Het
Ccdc96 A G 5: 36,643,596 (GRCm39) E534G probably damaging Het
Cdc42bpg G T 19: 6,368,485 (GRCm39) G1061V probably damaging Het
Cers3 T C 7: 66,393,468 (GRCm39) Y26H probably benign Het
Chd1l G A 3: 97,494,483 (GRCm39) A399V probably damaging Het
Clca4a T A 3: 144,663,059 (GRCm39) T597S probably benign Het
Daxx T A 17: 34,131,345 (GRCm39) probably null Het
Egf T C 3: 129,512,737 (GRCm39) probably benign Het
Eps15 A G 4: 109,226,145 (GRCm39) D629G probably damaging Het
Fancm G A 12: 65,144,262 (GRCm39) A575T probably benign Het
Fat4 G A 3: 38,945,036 (GRCm39) D1310N probably damaging Het
Grxcr2 G A 18: 42,131,766 (GRCm39) P101L possibly damaging Het
Hsd17b12 A T 2: 93,874,228 (GRCm39) I225N probably damaging Het
Kcnj8 T C 6: 142,511,773 (GRCm39) Y278C probably damaging Het
Lama3 G A 18: 12,615,205 (GRCm39) probably null Het
Lax1 C T 1: 133,607,530 (GRCm39) D404N probably benign Het
Lipg T C 18: 75,081,095 (GRCm39) K329E probably damaging Het
Lysmd2 T G 9: 75,542,984 (GRCm39) L197R probably damaging Het
Maneal A T 4: 124,750,964 (GRCm39) I264N probably damaging Het
Myh4 A G 11: 67,149,455 (GRCm39) N1729S probably benign Het
Myl2 A G 5: 122,244,791 (GRCm39) N154D possibly damaging Het
Nlrp9c T A 7: 26,081,812 (GRCm39) D638V probably damaging Het
Notch1 T C 2: 26,362,110 (GRCm39) H74R unknown Het
Olfml3 A T 3: 103,643,523 (GRCm39) V286D possibly damaging Het
Or14c46 T G 7: 85,918,090 (GRCm39) K302N probably benign Het
Or4b12 G A 2: 90,096,052 (GRCm39) H241Y probably damaging Het
Or51a25 G T 7: 102,373,287 (GRCm39) R137S possibly damaging Het
Or51f23c-ps1 A G 7: 102,431,603 (GRCm39) K307E probably benign Het
Or8k41 T C 2: 86,313,565 (GRCm39) I174V possibly damaging Het
Parn A C 16: 13,474,789 (GRCm39) F127V probably damaging Het
Pcdhac2 T C 18: 37,277,758 (GRCm39) V246A probably damaging Het
Plin2 G A 4: 86,580,224 (GRCm39) T90I possibly damaging Het
Podxl C T 6: 31,501,981 (GRCm39) C326Y probably damaging Het
Pramel46 A G 5: 95,418,684 (GRCm39) L104P probably damaging Het
Prl8a8 T A 13: 27,691,335 (GRCm39) K223* probably null Het
Ptprh T G 7: 4,583,989 (GRCm39) E201A possibly damaging Het
Rtn1 A C 12: 72,355,103 (GRCm39) V281G probably damaging Het
Scaf8 T C 17: 3,221,394 (GRCm39) S294P unknown Het
Shroom3 C A 5: 93,089,420 (GRCm39) N723K probably benign Het
Spata22 T C 11: 73,244,572 (GRCm39) *312R probably null Het
Stx7 T C 10: 24,060,969 (GRCm39) probably null Het
Taar6 T C 10: 23,861,021 (GRCm39) D175G probably benign Het
Tbccd1 A C 16: 22,641,216 (GRCm39) L387R probably damaging Het
Tecpr1 T C 5: 144,146,792 (GRCm39) M525V probably benign Het
Tex10 A T 4: 48,436,450 (GRCm39) I756N probably damaging Het
Tfap2d G C 1: 19,174,702 (GRCm39) G52R probably benign Het
Ttn T C 2: 76,572,341 (GRCm39) E24438G probably damaging Het
Tut4 A G 4: 108,384,002 (GRCm39) K1053R probably damaging Het
Wdpcp C T 11: 21,661,631 (GRCm39) T301I possibly damaging Het
Zbtb1 C T 12: 76,433,247 (GRCm39) T411I probably benign Het
Zzef1 G A 11: 72,804,129 (GRCm39) G2624R probably benign Het
Other mutations in Gm11595
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gm11595 APN 11 99,662,868 (GRCm39) missense unknown
IGL00987:Gm11595 APN 11 99,663,365 (GRCm39) missense unknown
IGL01662:Gm11595 APN 11 99,663,498 (GRCm39) missense unknown
IGL01994:Gm11595 APN 11 99,663,027 (GRCm39) missense unknown
R0548:Gm11595 UTSW 11 99,662,967 (GRCm39) missense unknown
R1923:Gm11595 UTSW 11 99,663,365 (GRCm39) missense unknown
R2127:Gm11595 UTSW 11 99,663,327 (GRCm39) missense unknown
R2128:Gm11595 UTSW 11 99,663,327 (GRCm39) missense unknown
R3807:Gm11595 UTSW 11 99,663,380 (GRCm39) missense unknown
R4007:Gm11595 UTSW 11 99,662,861 (GRCm39) missense unknown
R5281:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5283:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5303:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5305:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5306:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5307:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5308:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5561:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5637:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5639:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5718:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5719:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5720:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5721:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5769:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5770:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5771:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5791:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R5841:Gm11595 UTSW 11 99,663,143 (GRCm39) missense unknown
R6054:Gm11595 UTSW 11 99,663,474 (GRCm39) missense unknown
R6277:Gm11595 UTSW 11 99,663,510 (GRCm39) missense unknown
R6281:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6282:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6310:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6321:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6322:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6327:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6337:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6368:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6369:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6431:Gm11595 UTSW 11 99,663,600 (GRCm39) missense unknown
R6483:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6485:Gm11595 UTSW 11 99,663,381 (GRCm39) missense unknown
R6758:Gm11595 UTSW 11 99,663,367 (GRCm39) nonsense probably null
R6758:Gm11595 UTSW 11 99,663,366 (GRCm39) missense unknown
R7037:Gm11595 UTSW 11 99,663,474 (GRCm39) missense unknown
R8053:Gm11595 UTSW 11 99,662,954 (GRCm39) missense unknown
R8911:Gm11595 UTSW 11 99,663,564 (GRCm39) missense unknown
R9632:Gm11595 UTSW 11 99,663,097 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGAACTACCACAGCAGGGG -3'
(R):5'- CACCATGGTCAGTTCCTGTTG -3'

Sequencing Primer
(F):5'- CGACAGCAGCTGGAGATG -3'
(R):5'- TGCCAGACCACCTGCTGTAG -3'
Posted On 2018-06-06