Incidental Mutation 'R6491:Ap2a1'
ID522875
Institutional Source Beutler Lab
Gene Symbol Ap2a1
Ensembl Gene ENSMUSG00000060279
Gene Nameadaptor-related protein complex 2, alpha 1 subunit
SynonymsAdtaa
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.376) question?
Stock #R6491 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location44900373-44929496 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44916164 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 93 (I93K)
Ref Sequence ENSEMBL: ENSMUSP00000127497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085399] [ENSMUST00000107857] [ENSMUST00000166972] [ENSMUST00000167930] [ENSMUST00000208405]
Predicted Effect probably damaging
Transcript: ENSMUST00000085399
AA Change: I93K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082519
Gene: ENSMUSG00000060279
AA Change: I93K

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7.5e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 699 741 N/A INTRINSIC
Alpha_adaptinC2 745 858 4.49e-23 SMART
Pfam:Alpha_adaptin_C 864 972 9.4e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107857
AA Change: I93K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103489
Gene: ENSMUSG00000060279
AA Change: I93K

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Alpha_adaptinC2 723 836 4.49e-23 SMART
Pfam:Alpha_adaptin_C 842 950 9.1e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166972
AA Change: I93K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127842
Gene: ENSMUSG00000060279
AA Change: I93K

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 2e-149 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 699 741 N/A INTRINSIC
Alpha_adaptinC2 745 858 4.49e-23 SMART
Pfam:Alpha_adaptin_C 864 972 5.4e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167930
AA Change: I93K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127497
Gene: ENSMUSG00000060279
AA Change: I93K

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Alpha_adaptinC2 723 836 4.49e-23 SMART
Pfam:Alpha_adaptin_C 842 950 9.1e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208285
Predicted Effect probably benign
Transcript: ENSMUST00000208405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208813
Meta Mutation Damage Score 0.9511 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 adaptin subunit of the adaptor protein 2 (AP-2) complex found in clathrin coated vesicles. The AP-2 complex is a heterotetramer consisting of two large adaptins (alpha or beta), a medium adaptin (mu), and a small adaptin (sigma). The complex is part of the protein coat on the cytoplasmic face of coated vesicles which links clathrin to receptors in vesicles. Alternative splicing of this gene results in two transcript variants encoding two different isoforms. A third transcript variant has been described, but its full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,475,972 L431P probably damaging Het
Acad10 A C 5: 121,630,157 W779G probably damaging Het
Acrbp A G 6: 125,051,479 probably benign Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
Arnt T A 3: 95,476,143 M240K probably damaging Het
Ceacam12 A T 7: 18,069,260 K197M probably damaging Het
Cep41 T C 6: 30,656,484 N323S probably benign Het
Dst A G 1: 34,193,012 T2904A probably benign Het
Eml1 G A 12: 108,513,071 probably null Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Irf2bpl A G 12: 86,883,464 V145A probably benign Het
Itga2b T C 11: 102,459,869 probably null Het
Itga8 T C 2: 12,204,776 D466G probably damaging Het
Kdm4c G T 4: 74,373,636 C830F probably damaging Het
Mrps27 T C 13: 99,363,030 S73P probably damaging Het
Mtdh T G 15: 34,116,327 N17K probably damaging Het
Muc3a A G 5: 137,212,128 S9P probably benign Het
Olfr910 A G 9: 38,647,455 L23P probably damaging Het
Oxgr1 T A 14: 120,022,007 I263F probably benign Het
Phc1 A G 6: 122,334,964 Het
Ppp2r5d A G 17: 46,685,583 F388S probably damaging Het
Pxmp4 A G 2: 154,592,163 probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 A G 4: 100,409,912 N270S possibly damaging Het
Slc7a14 T C 3: 31,223,944 Y504C probably damaging Het
Snx9 A G 17: 5,920,162 D391G probably benign Het
St18 T A 1: 6,827,985 Y670* probably null Het
Tjp1 A T 7: 65,337,117 F207I possibly damaging Het
Trappc3 A G 4: 126,275,229 I171V probably benign Het
Ugt2b5 A T 5: 87,125,469 L446* probably null Het
Vmn2r105 A T 17: 20,227,730 Y277* probably null Het
Vmn2r11 A T 5: 109,048,934 N557K possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp938 A G 10: 82,227,529 *65Q probably null Het
Other mutations in Ap2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Ap2a1 APN 7 44905768 missense probably damaging 1.00
IGL01315:Ap2a1 APN 7 44916289 missense possibly damaging 0.47
IGL01324:Ap2a1 APN 7 44905696 missense probably damaging 1.00
IGL02545:Ap2a1 APN 7 44906426 missense probably damaging 1.00
IGL03067:Ap2a1 APN 7 44903511 missense probably benign
IGL03172:Ap2a1 APN 7 44904055 missense probably benign 0.00
disaffected UTSW 7 44916164 missense probably damaging 1.00
R0233:Ap2a1 UTSW 7 44915973 missense probably damaging 1.00
R0233:Ap2a1 UTSW 7 44915973 missense probably damaging 1.00
R0546:Ap2a1 UTSW 7 44904708 missense probably damaging 0.97
R1103:Ap2a1 UTSW 7 44904169 unclassified probably benign
R1566:Ap2a1 UTSW 7 44903480 missense probably benign 0.02
R1682:Ap2a1 UTSW 7 44915938 missense probably benign 0.14
R1745:Ap2a1 UTSW 7 44906945 missense probably damaging 1.00
R1777:Ap2a1 UTSW 7 44904152 missense probably damaging 1.00
R4627:Ap2a1 UTSW 7 44904419 missense probably damaging 1.00
R4669:Ap2a1 UTSW 7 44902919 unclassified probably benign
R4776:Ap2a1 UTSW 7 44901546 unclassified probably benign
R4909:Ap2a1 UTSW 7 44906381 missense probably damaging 1.00
R5040:Ap2a1 UTSW 7 44905804 missense possibly damaging 0.78
R5278:Ap2a1 UTSW 7 44902779 missense probably benign 0.00
R5310:Ap2a1 UTSW 7 44906065 splice site probably null
R5517:Ap2a1 UTSW 7 44906981 missense possibly damaging 0.93
R5635:Ap2a1 UTSW 7 44923901 intron probably benign
R6002:Ap2a1 UTSW 7 44904395 unclassified probably null
R6083:Ap2a1 UTSW 7 44907751 missense probably damaging 1.00
R6185:Ap2a1 UTSW 7 44916170 missense probably damaging 1.00
R6430:Ap2a1 UTSW 7 44903829 missense probably benign
R7058:Ap2a1 UTSW 7 44900791 missense probably damaging 1.00
R7180:Ap2a1 UTSW 7 44923804 intron probably null
R7490:Ap2a1 UTSW 7 44902789 missense probably benign 0.03
R7765:Ap2a1 UTSW 7 44909736 missense probably damaging 1.00
R7831:Ap2a1 UTSW 7 44901012 missense probably damaging 1.00
R7914:Ap2a1 UTSW 7 44901012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGGTCATTCTTGATAGCG -3'
(R):5'- TTAGGGGACGCTTCCTTACTTG -3'

Sequencing Primer
(F):5'- AGCCGGATCAGTTCTGAGTTC -3'
(R):5'- GACGCTTCCTTACTTGGCTCC -3'
Posted On2018-06-06