Mutagenetix > Incidental Mutations

Incidental Mutation 'R6493:Abca5'

522876

Institutional Source

Beutler Lab

Gene Symbol

Abca5

Ensembl Gene

ENSMUSG00000018800

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 5

Synonyms

ABC13, B930033A02Rik

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_147219.2; MGI: 2386607

Is this an essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R6493 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

110269369-110337716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 110293878 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 934 (H934L)

Ref Sequence

ENSEMBL: ENSMUSP00000120708 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043961] [ENSMUST00000124714]

AlphaFold

Q8K448

Predicted Effect

probably benign
Transcript: ENSMUST00000043961
AA Change: H934L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000047927
Gene: ENSMUSG00000018800
AA Change: H934L

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	29	416	4.3e-33	PFAM
AAA	506	691	2.88e-8	SMART
low complexity region	733	744	N/A	INTRINSIC
transmembrane domain	864	886	N/A	INTRINSIC
transmembrane domain	971	993	N/A	INTRINSIC
low complexity region	1262	1267	N/A	INTRINSIC
AAA	1325	1512	3.52e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124714
AA Change: H934L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000120708
Gene: ENSMUSG00000018800
AA Change: H934L

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	30	416	9.5e-32	PFAM
AAA	506	691	2.88e-8	SMART
low complexity region	733	744	N/A	INTRINSIC
transmembrane domain	864	886	N/A	INTRINSIC
transmembrane domain	971	993	N/A	INTRINSIC
transmembrane domain	1019	1041	N/A	INTRINSIC
transmembrane domain	1074	1096	N/A	INTRINSIC
transmembrane domain	1103	1125	N/A	INTRINSIC
transmembrane domain	1136	1158	N/A	INTRINSIC
transmembrane domain	1165	1187	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 97.3%
20x: 91.3%

Validation Efficiency

MGI Phenotype

Strain: 3581814
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24, but neither the substrate nor the function of this gene is known. Alternative splicing of this gene results in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit exophthalmos, tremors and collapse of the thyroid gland, and develop a dilated cardiomyopathy with large thrombi due to depression of the cardiac function. Severe edema, liver injury and premature death appear to be sensitive to genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	G	A	5: 8,824,698	D453N	probably damaging	Het
Ampd3	A	G	7: 110,795,811		probably null	Het
Axdnd1	A	T	1: 156,380,813	I485N	probably damaging	Het
Bscl2	A	G	19: 8,839,774	D22G	probably damaging	Het
Ccdc96	A	G	5: 36,486,252	E534G	probably damaging	Het
Cdc42bpg	G	T	19: 6,318,455	G1061V	probably damaging	Het
Cers3	T	C	7: 66,743,720	Y26H	probably benign	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Clca4a	T	A	3: 144,957,298	T597S	probably benign	Het
Daxx	T	A	17: 33,912,371		probably null	Het
Egf	T	C	3: 129,719,088		probably benign	Het
Eps15	A	G	4: 109,368,948	D629G	probably damaging	Het
Fancm	G	A	12: 65,097,488	A575T	probably benign	Het
Fat4	G	A	3: 38,890,887	D1310N	probably damaging	Het
Gm10424	A	G	5: 95,270,825	L104P	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Grxcr2	G	A	18: 41,998,701	P101L	possibly damaging	Het
Hsd17b12	A	T	2: 94,043,883	I225N	probably damaging	Het
Kcnj8	T	C	6: 142,566,047	Y278C	probably damaging	Het
Lama3	G	A	18: 12,482,148		probably null	Het
Lax1	C	T	1: 133,679,792	D404N	probably benign	Het
Lipg	T	C	18: 74,948,024	K329E	probably damaging	Het
Lysmd2	T	G	9: 75,635,702	L197R	probably damaging	Het
Maneal	A	T	4: 124,857,171	I264N	probably damaging	Het
Myh4	A	G	11: 67,258,629	N1729S	probably benign	Het
Myl2	A	G	5: 122,106,728	N154D	possibly damaging	Het
Nlrp9c	T	A	7: 26,382,387	D638V	probably damaging	Het
Notch1	T	C	2: 26,472,098	H74R	unknown	Het
Olfml3	A	T	3: 103,736,207	V286D	possibly damaging	Het
Olfr1271	G	A	2: 90,265,708	H241Y	probably damaging	Het
Olfr228	T	C	2: 86,483,221	I174V	possibly damaging	Het
Olfr310	T	G	7: 86,268,882	K302N	probably benign	Het
Olfr559	G	T	7: 102,724,080	R137S	possibly damaging	Het
Olfr562-ps1	A	G	7: 102,782,396	K307E	probably benign	Het
Parn	A	C	16: 13,656,925	F127V	probably damaging	Het
Pcdhac2	T	C	18: 37,144,705	V246A	probably damaging	Het
Plin2	G	A	4: 86,661,987	T90I	possibly damaging	Het
Podxl	C	T	6: 31,525,046	C326Y	probably damaging	Het
Prl8a8	T	A	13: 27,507,352	K223*	probably null	Het
Ptprh	T	G	7: 4,580,990	E201A	possibly damaging	Het
Rtn1	A	C	12: 72,308,329	V281G	probably damaging	Het
Scaf8	T	C	17: 3,171,119	S294P	unknown	Het
Shroom3	C	A	5: 92,941,561	N723K	probably benign	Het
Spata22	T	C	11: 73,353,746	*312R	probably null	Het
Stx7	T	C	10: 24,185,071		probably null	Het
Taar6	T	C	10: 23,985,123	D175G	probably benign	Het
Tbccd1	A	C	16: 22,822,466	L387R	probably damaging	Het
Tecpr1	T	C	5: 144,209,974	M525V	probably benign	Het
Tex10	A	T	4: 48,436,450	I756N	probably damaging	Het
Tfap2d	G	C	1: 19,104,478	G52R	probably benign	Het
Ttn	T	C	2: 76,741,997	E24438G	probably damaging	Het
Wdpcp	C	T	11: 21,711,631	T301I	possibly damaging	Het
Zbtb1	C	T	12: 76,386,473	T411I	probably benign	Het
Zcchc11	A	G	4: 108,526,805	K1053R	probably damaging	Het
Zzef1	G	A	11: 72,913,303	G2624R	probably benign	Het

Other mutations in Abca5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00487:Abca5	APN	11	110309450	critical splice acceptor site	probably null
IGL00675:Abca5	APN	11	110304985	missense	probably damaging	1.00
IGL01512:Abca5	APN	11	110317823	missense	probably benign	0.40
IGL01559:Abca5	APN	11	110272526	missense	probably benign
IGL01584:Abca5	APN	11	110304923	missense	probably damaging	0.98
IGL01604:Abca5	APN	11	110277636	missense	possibly damaging	0.47
IGL01828:Abca5	APN	11	110287695	missense	probably benign
IGL01880:Abca5	APN	11	110293263	missense	probably benign	0.01
IGL02054:Abca5	APN	11	110292123	missense	probably damaging	0.99
IGL02074:Abca5	APN	11	110293350	missense	probably benign	0.00
IGL02233:Abca5	APN	11	110274344	nonsense	probably null
IGL02245:Abca5	APN	11	110298169	nonsense	probably null
IGL02317:Abca5	APN	11	110327761	missense	probably benign	0.09
IGL02352:Abca5	APN	11	110275330	missense	probably benign	0.01
IGL02359:Abca5	APN	11	110275330	missense	probably benign	0.01
IGL02390:Abca5	APN	11	110296551	missense	probably benign
IGL02600:Abca5	APN	11	110309438	missense	probably benign	0.02
IGL02639:Abca5	APN	11	110288073	missense	possibly damaging	0.79
IGL03000:Abca5	APN	11	110317814	missense	probably benign	0.04
IGL03074:Abca5	APN	11	110310275	missense	probably benign	0.01
IGL03078:Abca5	APN	11	110276545	nonsense	probably null
IGL03342:Abca5	APN	11	110287691	missense	possibly damaging	0.94
IGL03368:Abca5	APN	11	110313522	splice site	probably benign
atles	UTSW	11	110299929	missense	probably damaging	0.99
Demento	UTSW	11	110310233	missense	probably damaging	1.00
jones	UTSW	11	110288058	splice site	probably null
smith	UTSW	11	110301545	missense	probably benign	0.22
R0106:Abca5	UTSW	11	110319825	missense	probably damaging	1.00
R0116:Abca5	UTSW	11	110276505	missense	probably damaging	1.00
R0305:Abca5	UTSW	11	110273311	splice site	probably benign
R0550:Abca5	UTSW	11	110293840	missense	probably damaging	1.00
R0578:Abca5	UTSW	11	110276489	nonsense	probably null
R0587:Abca5	UTSW	11	110311377	missense	probably benign	0.00
R0610:Abca5	UTSW	11	110301527	missense	probably benign	0.00
R0617:Abca5	UTSW	11	110279689	missense	probably damaging	0.98
R0667:Abca5	UTSW	11	110327811	missense	probably benign	0.00
R0844:Abca5	UTSW	11	110319832	missense	probably benign	0.00
R1273:Abca5	UTSW	11	110326665	missense	probably benign	0.01
R1463:Abca5	UTSW	11	110314558	missense	probably damaging	1.00
R1511:Abca5	UTSW	11	110299978	missense	probably damaging	1.00
R1511:Abca5	UTSW	11	110299986	missense	possibly damaging	0.73
R1687:Abca5	UTSW	11	110293888	missense	probably benign	0.32
R1759:Abca5	UTSW	11	110293848	missense	probably benign
R1870:Abca5	UTSW	11	110329217	missense	probably benign	0.33
R2006:Abca5	UTSW	11	110313449	missense	probably benign
R2039:Abca5	UTSW	11	110299929	missense	probably damaging	0.99
R2076:Abca5	UTSW	11	110287652	missense	probably benign	0.10
R2136:Abca5	UTSW	11	110319832	missense	probably benign	0.00
R2154:Abca5	UTSW	11	110292174	missense	probably benign	0.00
R2273:Abca5	UTSW	11	110275281	missense	possibly damaging	0.93
R2274:Abca5	UTSW	11	110275281	missense	possibly damaging	0.93
R2275:Abca5	UTSW	11	110275281	missense	possibly damaging	0.93
R2328:Abca5	UTSW	11	110276521	missense	probably damaging	0.99
R3702:Abca5	UTSW	11	110288058	splice site	probably null
R3768:Abca5	UTSW	11	110313391	missense	probably benign	0.01
R3872:Abca5	UTSW	11	110310233	missense	probably damaging	1.00
R3873:Abca5	UTSW	11	110310233	missense	probably damaging	1.00
R3874:Abca5	UTSW	11	110310233	missense	probably damaging	1.00
R3875:Abca5	UTSW	11	110310233	missense	probably damaging	1.00
R4347:Abca5	UTSW	11	110299968	missense	probably damaging	1.00
R4429:Abca5	UTSW	11	110311410	missense	probably benign	0.00
R4790:Abca5	UTSW	11	110311410	missense	possibly damaging	0.63
R4812:Abca5	UTSW	11	110301821	missense	probably damaging	1.00
R4833:Abca5	UTSW	11	110279316	missense	probably benign	0.00
R4883:Abca5	UTSW	11	110326631	missense	probably damaging	1.00
R5000:Abca5	UTSW	11	110310224	missense	probably damaging	1.00
R5004:Abca5	UTSW	11	110279376	missense	probably damaging	0.99
R5066:Abca5	UTSW	11	110309350	intron	probably benign
R5230:Abca5	UTSW	11	110319860	missense	probably benign
R5321:Abca5	UTSW	11	110327825	missense	probably benign
R5350:Abca5	UTSW	11	110319796	nonsense	probably null
R5414:Abca5	UTSW	11	110314622	missense	probably damaging	1.00
R5437:Abca5	UTSW	11	110319796	nonsense	probably null
R5451:Abca5	UTSW	11	110319796	nonsense	probably null
R5453:Abca5	UTSW	11	110319796	nonsense	probably null
R5488:Abca5	UTSW	11	110292183	missense	probably benign	0.00
R5636:Abca5	UTSW	11	110301536	missense	probably benign	0.00
R5805:Abca5	UTSW	11	110279390	missense	probably benign	0.06
R5900:Abca5	UTSW	11	110279156	missense	possibly damaging	0.92
R6152:Abca5	UTSW	11	110313361	missense	probably damaging	1.00
R6167:Abca5	UTSW	11	110292105	missense	probably benign	0.10
R6343:Abca5	UTSW	11	110314552	missense	probably damaging	1.00
R6425:Abca5	UTSW	11	110329232	missense	possibly damaging	0.75
R6498:Abca5	UTSW	11	110292102	missense	possibly damaging	0.70
R6884:Abca5	UTSW	11	110329217	missense	probably damaging	0.96
R6912:Abca5	UTSW	11	110306280	missense	probably benign	0.35
R7084:Abca5	UTSW	11	110301545	missense	probably benign	0.22
R7239:Abca5	UTSW	11	110326704	missense	possibly damaging	0.94
R7490:Abca5	UTSW	11	110277611	missense	possibly damaging	0.95
R7527:Abca5	UTSW	11	110327730	critical splice donor site	probably null
R7702:Abca5	UTSW	11	110276452	critical splice donor site	probably null
R7763:Abca5	UTSW	11	110272497	missense	possibly damaging	0.85
R8237:Abca5	UTSW	11	110310155	missense	probably benign	0.01
R8910:Abca5	UTSW	11	110298204	missense	probably damaging	0.96
R9028:Abca5	UTSW	11	110298078	missense	probably damaging	1.00
R9124:Abca5	UTSW	11	110298179	missense	possibly damaging	0.91
R9151:Abca5	UTSW	11	110298082	missense	probably benign
R9187:Abca5	UTSW	11	110310135	critical splice donor site	probably null
R9249:Abca5	UTSW	11	110329339	intron	probably benign
R9322:Abca5	UTSW	11	110301505	missense	probably damaging	0.96
R9391:Abca5	UTSW	11	110287716	missense	probably benign
R9435:Abca5	UTSW	11	110292085	critical splice donor site	probably null
RF014:Abca5	UTSW	11	110279754	critical splice acceptor site	probably null
Z1177:Abca5	UTSW	11	110279328	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GGGATAGGTTCAGCCAACTG -3'
(R):5'- TACTAATATTGTTGTAGGCAGCAGG -3'

Sequencing Primer
(F):5'- TGACCTCAGAGCAACCATGTCAG -3'
(R):5'- ACAAGGTAGTCAGACTTCTCCTTGG -3'

Posted On

2018-06-06