Incidental Mutation 'R6491:Olfr910'
ID522879
Institutional Source Beutler Lab
Gene Symbol Olfr910
Ensembl Gene ENSMUSG00000060114
Gene Nameolfactory receptor 910
SynonymsMOR165-3, GA_x6K02T2PVTD-32239063-32239995
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R6491 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location38537849-38540820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38647455 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 23 (L23P)
Ref Sequence ENSEMBL: ENSMUSP00000149860 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000215191
AA Change: L23P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000215291
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,475,972 L431P probably damaging Het
Acad10 A C 5: 121,630,157 W779G probably damaging Het
Acrbp A G 6: 125,051,479 probably benign Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
Ap2a1 A T 7: 44,916,164 I93K probably damaging Het
Arnt T A 3: 95,476,143 M240K probably damaging Het
Ceacam12 A T 7: 18,069,260 K197M probably damaging Het
Cep41 T C 6: 30,656,484 N323S probably benign Het
Dst A G 1: 34,193,012 T2904A probably benign Het
Eml1 G A 12: 108,513,071 probably null Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Irf2bpl A G 12: 86,883,464 V145A probably benign Het
Itga2b T C 11: 102,459,869 probably null Het
Itga8 T C 2: 12,204,776 D466G probably damaging Het
Kdm4c G T 4: 74,373,636 C830F probably damaging Het
Mrps27 T C 13: 99,363,030 S73P probably damaging Het
Mtdh T G 15: 34,116,327 N17K probably damaging Het
Muc3a A G 5: 137,212,128 S9P probably benign Het
Oxgr1 T A 14: 120,022,007 I263F probably benign Het
Phc1 A G 6: 122,334,964 Het
Ppp2r5d A G 17: 46,685,583 F388S probably damaging Het
Pxmp4 A G 2: 154,592,163 probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 A G 4: 100,409,912 N270S possibly damaging Het
Slc7a14 T C 3: 31,223,944 Y504C probably damaging Het
Snx9 A G 17: 5,920,162 D391G probably benign Het
St18 T A 1: 6,827,985 Y670* probably null Het
Tjp1 A T 7: 65,337,117 F207I possibly damaging Het
Trappc3 A G 4: 126,275,229 I171V probably benign Het
Ugt2b5 A T 5: 87,125,469 L446* probably null Het
Vmn2r105 A T 17: 20,227,730 Y277* probably null Het
Vmn2r11 A T 5: 109,048,934 N557K possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp938 A G 10: 82,227,529 *65Q probably null Het
Other mutations in Olfr910
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02740:Olfr910 APN 9 38538930 missense probably damaging 1.00
R0096:Olfr910 UTSW 9 38539536 missense probably damaging 0.96
R0550:Olfr910 UTSW 9 38539380 missense probably damaging 0.97
R1375:Olfr910 UTSW 9 38539534 missense possibly damaging 0.63
R1698:Olfr910 UTSW 9 38539256 nonsense probably null
R2067:Olfr910 UTSW 9 38539280 missense probably benign 0.09
R2111:Olfr910 UTSW 9 38539280 missense probably benign 0.09
R2519:Olfr910 UTSW 9 38538985 missense probably damaging 0.99
R4742:Olfr910 UTSW 9 38539656 missense probably damaging 1.00
R4782:Olfr910 UTSW 9 38539075 missense probably damaging 1.00
R7101:Olfr910 UTSW 9 38539670 missense probably benign 0.02
R8108:Olfr910 UTSW 9 38539410 missense probably damaging 0.97
R8270:Olfr910 UTSW 9 38539348 missense noncoding transcript
Z1088:Olfr910 UTSW 9 38539149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTGGGTCATGCATCCTCT -3'
(R):5'- TGACGGACACAAAAGAGCAT -3'

Sequencing Primer
(F):5'- GGGTCATGCATCCTCTATAGG -3'
(R):5'- AGGAAAAAGTTATGTTGGTGATACTC -3'
Posted On2018-06-06