Incidental Mutation 'R6491:Itga2b'
ID522887
Institutional Source Beutler Lab
Gene Symbol Itga2b
Ensembl Gene ENSMUSG00000034664
Gene Nameintegrin alpha 2b
Synonymsplatelet glycoprotein IIb, GpIIb, alphaIIb, GP IIb, CD41
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R6491 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location102453297-102470122 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 102459869 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103086] [ENSMUST00000103086] [ENSMUST00000103086]
Predicted Effect probably null
Transcript: ENSMUST00000103086
SMART Domains Protein: ENSMUSP00000099375
Gene: ENSMUSG00000034664

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Int_alpha 46 103 2.34e-10 SMART
Int_alpha 261 311 1.3e-3 SMART
Int_alpha 315 376 4.9e-13 SMART
Int_alpha 382 438 4.34e-14 SMART
Int_alpha 443 494 4.05e-5 SMART
low complexity region 552 567 N/A INTRINSIC
SCOP:d1m1xa2 635 770 1e-48 SMART
SCOP:d1m1xa3 775 995 3e-66 SMART
Pfam:Integrin_alpha 1015 1029 5.7e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000103086
SMART Domains Protein: ENSMUSP00000099375
Gene: ENSMUSG00000034664

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Int_alpha 46 103 2.34e-10 SMART
Int_alpha 261 311 1.3e-3 SMART
Int_alpha 315 376 4.9e-13 SMART
Int_alpha 382 438 4.34e-14 SMART
Int_alpha 443 494 4.05e-5 SMART
low complexity region 552 567 N/A INTRINSIC
SCOP:d1m1xa2 635 770 1e-48 SMART
SCOP:d1m1xa3 775 995 3e-66 SMART
Pfam:Integrin_alpha 1015 1029 5.7e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000103086
SMART Domains Protein: ENSMUSP00000099375
Gene: ENSMUSG00000034664

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Int_alpha 46 103 2.34e-10 SMART
Int_alpha 261 311 1.3e-3 SMART
Int_alpha 315 376 4.9e-13 SMART
Int_alpha 382 438 4.34e-14 SMART
Int_alpha 443 494 4.05e-5 SMART
low complexity region 552 567 N/A INTRINSIC
SCOP:d1m1xa2 635 770 1e-48 SMART
SCOP:d1m1xa3 775 995 3e-66 SMART
Pfam:Integrin_alpha 1015 1029 5.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174900
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the integrin alpha chain family of proteins. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate through disulfide linkages to form a subunit of the alpha-IIb/beta-3 integrin cell adhesion receptor. This receptor plays a crucial role in the blood coagulation system, by mediating platelet aggregation. Mutations in this gene are associated with platelet-type bleeding disorders, which are characterized by a failure of platelet aggregation, including Glanzmann thrombasthenia. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a bleeding disorder, lack platelet binding to fibrinogen, absence of fibrinogen in platelet alpha granules, and increased numbers of hematopoietic progenitors in yolk sac, fetal liver, and bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,475,972 L431P probably damaging Het
Acad10 A C 5: 121,630,157 W779G probably damaging Het
Acrbp A G 6: 125,051,479 probably benign Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
Ap2a1 A T 7: 44,916,164 I93K probably damaging Het
Arnt T A 3: 95,476,143 M240K probably damaging Het
Ceacam12 A T 7: 18,069,260 K197M probably damaging Het
Cep41 T C 6: 30,656,484 N323S probably benign Het
Dst A G 1: 34,193,012 T2904A probably benign Het
Eml1 G A 12: 108,513,071 probably null Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Irf2bpl A G 12: 86,883,464 V145A probably benign Het
Itga8 T C 2: 12,204,776 D466G probably damaging Het
Kdm4c G T 4: 74,373,636 C830F probably damaging Het
Mrps27 T C 13: 99,363,030 S73P probably damaging Het
Mtdh T G 15: 34,116,327 N17K probably damaging Het
Muc3a A G 5: 137,212,128 S9P probably benign Het
Olfr910 A G 9: 38,647,455 L23P probably damaging Het
Oxgr1 T A 14: 120,022,007 I263F probably benign Het
Phc1 A G 6: 122,334,964 Het
Ppp2r5d A G 17: 46,685,583 F388S probably damaging Het
Pxmp4 A G 2: 154,592,163 probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 A G 4: 100,409,912 N270S possibly damaging Het
Slc7a14 T C 3: 31,223,944 Y504C probably damaging Het
Snx9 A G 17: 5,920,162 D391G probably benign Het
St18 T A 1: 6,827,985 Y670* probably null Het
Tjp1 A T 7: 65,337,117 F207I possibly damaging Het
Trappc3 A G 4: 126,275,229 I171V probably benign Het
Ugt2b5 A T 5: 87,125,469 L446* probably null Het
Vmn2r105 A T 17: 20,227,730 Y277* probably null Het
Vmn2r11 A T 5: 109,048,934 N557K possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp938 A G 10: 82,227,529 *65Q probably null Het
Other mutations in Itga2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Itga2b APN 11 102455583 missense probably damaging 1.00
IGL02197:Itga2b APN 11 102466319 missense probably benign 0.19
IGL02349:Itga2b APN 11 102461363 missense probably damaging 0.98
IGL02711:Itga2b APN 11 102465725 missense possibly damaging 0.53
R0282:Itga2b UTSW 11 102460846 missense probably damaging 0.99
R0349:Itga2b UTSW 11 102467426 missense probably damaging 0.98
R0384:Itga2b UTSW 11 102465362 splice site probably null
R0403:Itga2b UTSW 11 102467326 critical splice donor site probably null
R0452:Itga2b UTSW 11 102465953 intron probably null
R0535:Itga2b UTSW 11 102457533 missense possibly damaging 0.65
R1412:Itga2b UTSW 11 102457005 missense probably benign 0.00
R1517:Itga2b UTSW 11 102466325 nonsense probably null
R1615:Itga2b UTSW 11 102460137 critical splice donor site probably null
R1716:Itga2b UTSW 11 102460777 missense probably benign 0.30
R1953:Itga2b UTSW 11 102458183 missense probably benign 0.18
R2001:Itga2b UTSW 11 102467339 missense probably benign
R2216:Itga2b UTSW 11 102467866 missense probably benign 0.35
R4193:Itga2b UTSW 11 102469685 missense probably benign 0.01
R4770:Itga2b UTSW 11 102460756 missense probably damaging 1.00
R4805:Itga2b UTSW 11 102467866 missense probably benign 0.00
R4880:Itga2b UTSW 11 102457722 intron probably benign
R4906:Itga2b UTSW 11 102461159 missense probably benign 0.43
R5112:Itga2b UTSW 11 102458191 missense probably damaging 0.99
R5362:Itga2b UTSW 11 102461135 missense probably damaging 0.99
R5739:Itga2b UTSW 11 102465909 missense probably benign 0.14
R5761:Itga2b UTSW 11 102466274 missense probably benign 0.00
R5840:Itga2b UTSW 11 102461331 missense probably damaging 1.00
R5851:Itga2b UTSW 11 102457601 intron probably benign
R6239:Itga2b UTSW 11 102465318 missense possibly damaging 0.61
R7426:Itga2b UTSW 11 102456294 missense probably benign 0.01
R7635:Itga2b UTSW 11 102461756 missense probably damaging 1.00
R7664:Itga2b UTSW 11 102460840 missense probably damaging 1.00
R7832:Itga2b UTSW 11 102457282 missense probably damaging 0.98
R7915:Itga2b UTSW 11 102457282 missense probably damaging 0.98
R8120:Itga2b UTSW 11 102469542 missense probably damaging 0.98
Z1177:Itga2b UTSW 11 102467076 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAACAGGGTTCTAGACATTTGAGC -3'
(R):5'- AGACCCACTCCTTACCTGAG -3'

Sequencing Primer
(F):5'- AGACATTTGAGCCTTTAGCCAGC -3'
(R):5'- TGGCCTAGTCCTAAACCAAGC -3'
Posted On2018-06-06