Incidental Mutation 'R6491:Mrps27'
ID522891
Institutional Source Beutler Lab
Gene Symbol Mrps27
Ensembl Gene ENSMUSG00000041632
Gene Namemitochondrial ribosomal protein S27
Synonyms2610028H14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.910) question?
Stock #R6491 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location99344786-99415562 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99363030 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 73 (S73P)
Ref Sequence ENSEMBL: ENSMUSP00000156296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052249] [ENSMUST00000224660]
Predicted Effect probably damaging
Transcript: ENSMUST00000052249
AA Change: S73P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062326
Gene: ENSMUSG00000041632
AA Change: S73P

DomainStartEndE-ValueType
Pfam:MRP-S27 1 413 8.3e-156 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224660
AA Change: S73P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225973
Meta Mutation Damage Score 0.5578 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that may be a functional partner of the death associated protein 3 (DAP3). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,475,972 L431P probably damaging Het
Acad10 A C 5: 121,630,157 W779G probably damaging Het
Acrbp A G 6: 125,051,479 probably benign Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
Ap2a1 A T 7: 44,916,164 I93K probably damaging Het
Arnt T A 3: 95,476,143 M240K probably damaging Het
Ceacam12 A T 7: 18,069,260 K197M probably damaging Het
Cep41 T C 6: 30,656,484 N323S probably benign Het
Dst A G 1: 34,193,012 T2904A probably benign Het
Eml1 G A 12: 108,513,071 probably null Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Irf2bpl A G 12: 86,883,464 V145A probably benign Het
Itga2b T C 11: 102,459,869 probably null Het
Itga8 T C 2: 12,204,776 D466G probably damaging Het
Kdm4c G T 4: 74,373,636 C830F probably damaging Het
Mtdh T G 15: 34,116,327 N17K probably damaging Het
Muc3a A G 5: 137,212,128 S9P probably benign Het
Olfr910 A G 9: 38,647,455 L23P probably damaging Het
Oxgr1 T A 14: 120,022,007 I263F probably benign Het
Phc1 A G 6: 122,334,964 Het
Ppp2r5d A G 17: 46,685,583 F388S probably damaging Het
Pxmp4 A G 2: 154,592,163 probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 A G 4: 100,409,912 N270S possibly damaging Het
Slc7a14 T C 3: 31,223,944 Y504C probably damaging Het
Snx9 A G 17: 5,920,162 D391G probably benign Het
St18 T A 1: 6,827,985 Y670* probably null Het
Tjp1 A T 7: 65,337,117 F207I possibly damaging Het
Trappc3 A G 4: 126,275,229 I171V probably benign Het
Ugt2b5 A T 5: 87,125,469 L446* probably null Het
Vmn2r105 A T 17: 20,227,730 Y277* probably null Het
Vmn2r11 A T 5: 109,048,934 N557K possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp938 A G 10: 82,227,529 *65Q probably null Het
Other mutations in Mrps27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01666:Mrps27 APN 13 99409816 missense probably damaging 1.00
IGL01685:Mrps27 APN 13 99414920 missense possibly damaging 0.52
P0043:Mrps27 UTSW 13 99412246 missense probably benign
R0122:Mrps27 UTSW 13 99365228 missense probably benign 0.13
R0502:Mrps27 UTSW 13 99409795 splice site probably benign
R0503:Mrps27 UTSW 13 99409795 splice site probably benign
R0611:Mrps27 UTSW 13 99405074 missense probably damaging 1.00
R1540:Mrps27 UTSW 13 99405050 missense probably benign 0.17
R2566:Mrps27 UTSW 13 99400328 nonsense probably null
R4227:Mrps27 UTSW 13 99411340 missense probably damaging 1.00
R4235:Mrps27 UTSW 13 99405041 missense probably damaging 1.00
R4715:Mrps27 UTSW 13 99414815 unclassified probably null
R4761:Mrps27 UTSW 13 99412231 missense probably benign 0.10
R5114:Mrps27 UTSW 13 99411465 unclassified probably benign
R5294:Mrps27 UTSW 13 99409873 missense probably damaging 1.00
R6241:Mrps27 UTSW 13 99412246 missense probably benign
R6387:Mrps27 UTSW 13 99400317 missense possibly damaging 0.80
R6992:Mrps27 UTSW 13 99405014 missense probably benign 0.16
R7165:Mrps27 UTSW 13 99414799 missense possibly damaging 0.89
R7241:Mrps27 UTSW 13 99411280 nonsense probably null
R7709:Mrps27 UTSW 13 99404996 missense probably benign 0.21
R7720:Mrps27 UTSW 13 99401330 missense unknown
Z1177:Mrps27 UTSW 13 99414843 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ACTTTGTGACGTTCTCGGCC -3'
(R):5'- GTTCACTGCTATGACACTGAAGG -3'

Sequencing Primer
(F):5'- CCATCTGGTAGGAGTCAGAGCTG -3'
(R):5'- TCAGTGATTACTAACTTGAGTCTGG -3'
Posted On2018-06-06