Incidental Mutation 'R6491:4833420G17Rik'
ID522893
Institutional Source Beutler Lab
Gene Symbol 4833420G17Rik
Ensembl Gene ENSMUSG00000062822
Gene NameRIKEN cDNA 4833420G17 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6491 (G1)
Quality Score216.009
Status Validated
Chromosome13
Chromosomal Location119462768-119486120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119475972 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 431 (L431P)
Ref Sequence ENSEMBL: ENSMUSP00000153079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026519] [ENSMUST00000224312] [ENSMUST00000225186] [ENSMUST00000225726]
Predicted Effect probably damaging
Transcript: ENSMUST00000026519
AA Change: L431P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026519
Gene: ENSMUSG00000062822
AA Change: L431P

DomainStartEndE-ValueType
Pfam:DUF4524 9 154 5e-61 PFAM
Pfam:DUF4520 451 542 8.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000048965
Predicted Effect probably damaging
Transcript: ENSMUST00000224312
AA Change: L431P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225186
AA Change: L431P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225726
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A C 5: 121,630,157 W779G probably damaging Het
Acrbp A G 6: 125,051,479 probably benign Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
Ap2a1 A T 7: 44,916,164 I93K probably damaging Het
Arnt T A 3: 95,476,143 M240K probably damaging Het
Ceacam12 A T 7: 18,069,260 K197M probably damaging Het
Cep41 T C 6: 30,656,484 N323S probably benign Het
Dst A G 1: 34,193,012 T2904A probably benign Het
Eml1 G A 12: 108,513,071 probably null Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Irf2bpl A G 12: 86,883,464 V145A probably benign Het
Itga2b T C 11: 102,459,869 probably null Het
Itga8 T C 2: 12,204,776 D466G probably damaging Het
Kdm4c G T 4: 74,373,636 C830F probably damaging Het
Mrps27 T C 13: 99,363,030 S73P probably damaging Het
Mtdh T G 15: 34,116,327 N17K probably damaging Het
Muc3a A G 5: 137,212,128 S9P probably benign Het
Olfr910 A G 9: 38,647,455 L23P probably damaging Het
Oxgr1 T A 14: 120,022,007 I263F probably benign Het
Phc1 A G 6: 122,334,964 Het
Ppp2r5d A G 17: 46,685,583 F388S probably damaging Het
Pxmp4 A G 2: 154,592,163 probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 A G 4: 100,409,912 N270S possibly damaging Het
Slc7a14 T C 3: 31,223,944 Y504C probably damaging Het
Snx9 A G 17: 5,920,162 D391G probably benign Het
St18 T A 1: 6,827,985 Y670* probably null Het
Tjp1 A T 7: 65,337,117 F207I possibly damaging Het
Trappc3 A G 4: 126,275,229 I171V probably benign Het
Ugt2b5 A T 5: 87,125,469 L446* probably null Het
Vmn2r105 A T 17: 20,227,730 Y277* probably null Het
Vmn2r11 A T 5: 109,048,934 N557K possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp938 A G 10: 82,227,529 *65Q probably null Het
Other mutations in 4833420G17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:4833420G17Rik APN 13 119466958 critical splice donor site probably null
IGL01555:4833420G17Rik APN 13 119473907 missense probably benign 0.10
IGL02395:4833420G17Rik APN 13 119480960 missense probably damaging 1.00
IGL02725:4833420G17Rik APN 13 119474909 missense possibly damaging 0.95
IGL02904:4833420G17Rik APN 13 119484454 missense probably damaging 1.00
IGL03126:4833420G17Rik APN 13 119481027 missense probably benign 0.23
R0410:4833420G17Rik UTSW 13 119469732 missense probably benign
R0437:4833420G17Rik UTSW 13 119470095 missense probably benign 0.35
R0513:4833420G17Rik UTSW 13 119469659 missense probably benign 0.13
R0569:4833420G17Rik UTSW 13 119484480 missense possibly damaging 0.94
R0788:4833420G17Rik UTSW 13 119473932 nonsense probably null
R1495:4833420G17Rik UTSW 13 119477820 missense probably benign 0.17
R1617:4833420G17Rik UTSW 13 119466937 missense probably damaging 1.00
R1905:4833420G17Rik UTSW 13 119469680 missense possibly damaging 0.92
R1914:4833420G17Rik UTSW 13 119485850 missense possibly damaging 0.90
R2169:4833420G17Rik UTSW 13 119485813 missense probably benign 0.09
R4238:4833420G17Rik UTSW 13 119466942 missense probably benign 0.00
R4240:4833420G17Rik UTSW 13 119466942 missense probably benign 0.00
R4295:4833420G17Rik UTSW 13 119469713 missense probably benign 0.02
R4469:4833420G17Rik UTSW 13 119469809 missense probably damaging 1.00
R4643:4833420G17Rik UTSW 13 119474860 missense probably damaging 0.97
R4964:4833420G17Rik UTSW 13 119474221 intron probably benign
R4966:4833420G17Rik UTSW 13 119474221 intron probably benign
R5093:4833420G17Rik UTSW 13 119474037 utr 3 prime probably benign
R5384:4833420G17Rik UTSW 13 119469960 missense probably benign 0.01
R6255:4833420G17Rik UTSW 13 119466123 missense possibly damaging 0.95
R6564:4833420G17Rik UTSW 13 119486077 unclassified probably null
R7023:4833420G17Rik UTSW 13 119473907 missense probably benign 0.10
R7574:4833420G17Rik UTSW 13 119469942 missense probably damaging 0.99
Z1176:4833420G17Rik UTSW 13 119477808 missense not run
Z1177:4833420G17Rik UTSW 13 119477808 missense not run
Predicted Primers PCR Primer
(F):5'- CTTCCTGGGAGTTGCCATAG -3'
(R):5'- ACCTGTCTATGAGGTAGGCATTC -3'

Sequencing Primer
(F):5'- CTGGGAGTTGCCATAGTCATCTAAAC -3'
(R):5'- CTCACTGCCTTTGAAGAGGAACTG -3'
Posted On2018-06-06