Incidental Mutation 'R6491:Mtdh'
ID522897
Institutional Source Beutler Lab
Gene Symbol Mtdh
Ensembl Gene ENSMUSG00000022255
Gene Namemetadherin
Synonyms3D3/Lyric, 2610103J23Rik, D8Bwg1112e, AEG-1, Lyric
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6491 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location34082694-34145624 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 34116327 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 17 (N17K)
Ref Sequence ENSEMBL: ENSMUSP00000131814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022865] [ENSMUST00000168991] [ENSMUST00000169905]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022865
AA Change: N253K

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022865
Gene: ENSMUSG00000022255
AA Change: N253K

DomainStartEndE-ValueType
Pfam:LYRIC 6 420 1e-143 PFAM
low complexity region 438 448 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163333
AA Change: N162K
SMART Domains Protein: ENSMUSP00000130190
Gene: ENSMUSG00000022255
AA Change: N162K

DomainStartEndE-ValueType
Pfam:LYRIC 4 256 2.3e-70 PFAM
Pfam:LYRIC 250 297 4.4e-13 PFAM
low complexity region 315 325 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163697
Predicted Effect probably benign
Transcript: ENSMUST00000168991
SMART Domains Protein: ENSMUSP00000129500
Gene: ENSMUSG00000022255

DomainStartEndE-ValueType
transmembrane domain 51 73 N/A INTRINSIC
low complexity region 111 127 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169905
AA Change: N17K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131814
Gene: ENSMUSG00000022255
AA Change: N17K

DomainStartEndE-ValueType
low complexity region 121 132 N/A INTRINSIC
low complexity region 232 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170050
SMART Domains Protein: ENSMUSP00000128288
Gene: ENSMUSG00000022255

DomainStartEndE-ValueType
Pfam:LYRIC 3 304 4.2e-90 PFAM
low complexity region 322 332 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000170553
AA Change: N98K
SMART Domains Protein: ENSMUSP00000126167
Gene: ENSMUSG00000022255
AA Change: N98K

DomainStartEndE-ValueType
Pfam:LYRIC 3 106 7.7e-28 PFAM
Pfam:LYRIC 99 220 3.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226331
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable and fertile with decreased incidence of tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,475,972 L431P probably damaging Het
Acad10 A C 5: 121,630,157 W779G probably damaging Het
Acrbp A G 6: 125,051,479 probably benign Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
Ap2a1 A T 7: 44,916,164 I93K probably damaging Het
Arnt T A 3: 95,476,143 M240K probably damaging Het
Ceacam12 A T 7: 18,069,260 K197M probably damaging Het
Cep41 T C 6: 30,656,484 N323S probably benign Het
Dst A G 1: 34,193,012 T2904A probably benign Het
Eml1 G A 12: 108,513,071 probably null Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Irf2bpl A G 12: 86,883,464 V145A probably benign Het
Itga2b T C 11: 102,459,869 probably null Het
Itga8 T C 2: 12,204,776 D466G probably damaging Het
Kdm4c G T 4: 74,373,636 C830F probably damaging Het
Mrps27 T C 13: 99,363,030 S73P probably damaging Het
Muc3a A G 5: 137,212,128 S9P probably benign Het
Olfr910 A G 9: 38,647,455 L23P probably damaging Het
Oxgr1 T A 14: 120,022,007 I263F probably benign Het
Phc1 A G 6: 122,334,964 Het
Ppp2r5d A G 17: 46,685,583 F388S probably damaging Het
Pxmp4 A G 2: 154,592,163 probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 A G 4: 100,409,912 N270S possibly damaging Het
Slc7a14 T C 3: 31,223,944 Y504C probably damaging Het
Snx9 A G 17: 5,920,162 D391G probably benign Het
St18 T A 1: 6,827,985 Y670* probably null Het
Tjp1 A T 7: 65,337,117 F207I possibly damaging Het
Trappc3 A G 4: 126,275,229 I171V probably benign Het
Ugt2b5 A T 5: 87,125,469 L446* probably null Het
Vmn2r105 A T 17: 20,227,730 Y277* probably null Het
Vmn2r11 A T 5: 109,048,934 N557K possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp938 A G 10: 82,227,529 *65Q probably null Het
Other mutations in Mtdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Mtdh APN 15 34083109 missense probably damaging 1.00
IGL01772:Mtdh APN 15 34139881 missense probably damaging 1.00
IGL02153:Mtdh APN 15 34131250 missense possibly damaging 0.93
IGL02392:Mtdh APN 15 34099577 missense probably damaging 0.98
IGL03052:Mtdh UTSW 15 34140730 missense possibly damaging 0.53
R0062:Mtdh UTSW 15 34134280 splice site probably benign
R0333:Mtdh UTSW 15 34118101 missense possibly damaging 0.86
R0791:Mtdh UTSW 15 34116382 splice site probably benign
R1472:Mtdh UTSW 15 34114045 missense possibly damaging 0.86
R1713:Mtdh UTSW 15 34114839 missense possibly damaging 0.86
R3605:Mtdh UTSW 15 34114112 splice site probably benign
R4626:Mtdh UTSW 15 34114834 nonsense probably null
R4957:Mtdh UTSW 15 34083135 missense possibly damaging 0.82
R5196:Mtdh UTSW 15 34118004 missense probably damaging 0.99
R5977:Mtdh UTSW 15 34099574 missense probably damaging 0.99
R6852:Mtdh UTSW 15 34136721 missense probably damaging 0.96
R7049:Mtdh UTSW 15 34131165 missense probably damaging 0.97
R7899:Mtdh UTSW 15 34123719 missense possibly damaging 0.92
R7982:Mtdh UTSW 15 34123719 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACTCAATTCCCTGTGAACATGTG -3'
(R):5'- CGAGTGTGAATGATCTTCCTTTTC -3'

Sequencing Primer
(F):5'- CCCTGTGAACATGTGAAATATGTTG -3'
(R):5'- TTTTCCATTTTTCAAATTCTCTGGAC -3'
Posted On2018-06-06