Incidental Mutation 'R6491:Snx9'
ID522899
Institutional Source Beutler Lab
Gene Symbol Snx9
Ensembl Gene ENSMUSG00000002365
Gene Namesorting nexin 9
SynonymsSH3PX1, SDP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock #R6491 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location5841329-5931954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5920162 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 391 (D391G)
Ref Sequence ENSEMBL: ENSMUSP00000002436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002436]
PDB Structure
Solution structure of the SH3 domain from mouse sorting nexin-9 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000002436
AA Change: D391G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000002436
Gene: ENSMUSG00000002365
AA Change: D391G

DomainStartEndE-ValueType
SH3 3 61 1.51e-16 SMART
low complexity region 84 100 N/A INTRINSIC
low complexity region 160 170 N/A INTRINSIC
PX 247 357 4.15e-23 SMART
Pfam:BAR_3_WASP_bdg 358 593 2.4e-120 PFAM
Meta Mutation Damage Score 0.3443 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phosphoinositide binding domain, and are involved in intracellular trafficking. The encoded protein does not contain a coiled coil region, like some family members, but does contain a SRC homology domain near its N-terminus. The encoded protein is reported to have a variety of interaction partners, including of adaptor protein 2 , dynamin, tyrosine kinase non-receptor 2, Wiskott-Aldrich syndrome-like, and ARP3 actin-related protein 3. The encoded protein is implicated in several stages of intracellular trafficking, including endocytosis, macropinocytosis, and F-actin nucleation. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,475,972 L431P probably damaging Het
Acad10 A C 5: 121,630,157 W779G probably damaging Het
Acrbp A G 6: 125,051,479 probably benign Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
Ap2a1 A T 7: 44,916,164 I93K probably damaging Het
Arnt T A 3: 95,476,143 M240K probably damaging Het
Ceacam12 A T 7: 18,069,260 K197M probably damaging Het
Cep41 T C 6: 30,656,484 N323S probably benign Het
Dst A G 1: 34,193,012 T2904A probably benign Het
Eml1 G A 12: 108,513,071 probably null Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Irf2bpl A G 12: 86,883,464 V145A probably benign Het
Itga2b T C 11: 102,459,869 probably null Het
Itga8 T C 2: 12,204,776 D466G probably damaging Het
Kdm4c G T 4: 74,373,636 C830F probably damaging Het
Mrps27 T C 13: 99,363,030 S73P probably damaging Het
Mtdh T G 15: 34,116,327 N17K probably damaging Het
Muc3a A G 5: 137,212,128 S9P probably benign Het
Olfr910 A G 9: 38,647,455 L23P probably damaging Het
Oxgr1 T A 14: 120,022,007 I263F probably benign Het
Phc1 A G 6: 122,334,964 Het
Ppp2r5d A G 17: 46,685,583 F388S probably damaging Het
Pxmp4 A G 2: 154,592,163 probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 A G 4: 100,409,912 N270S possibly damaging Het
Slc7a14 T C 3: 31,223,944 Y504C probably damaging Het
St18 T A 1: 6,827,985 Y670* probably null Het
Tjp1 A T 7: 65,337,117 F207I possibly damaging Het
Trappc3 A G 4: 126,275,229 I171V probably benign Het
Ugt2b5 A T 5: 87,125,469 L446* probably null Het
Vmn2r105 A T 17: 20,227,730 Y277* probably null Het
Vmn2r11 A T 5: 109,048,934 N557K possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp938 A G 10: 82,227,529 *65Q probably null Het
Other mutations in Snx9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Snx9 APN 17 5899361 missense probably benign
IGL00417:Snx9 APN 17 5891897 missense probably benign 0.03
IGL01827:Snx9 APN 17 5887012 missense probably benign 0.04
IGL02531:Snx9 APN 17 5891820 missense probably benign
IGL02710:Snx9 APN 17 5908598 missense probably damaging 1.00
IGL03088:Snx9 APN 17 5924610 missense probably benign
san_angelo UTSW 17 5891809 nonsense probably null
PIT4495001:Snx9 UTSW 17 5920126 missense possibly damaging 0.54
R0555:Snx9 UTSW 17 5918413 missense probably damaging 0.97
R1015:Snx9 UTSW 17 5920127 missense probably benign 0.12
R1065:Snx9 UTSW 17 5902361 splice site probably benign
R1421:Snx9 UTSW 17 5902484 missense probably benign 0.45
R1657:Snx9 UTSW 17 5918436 missense possibly damaging 0.65
R1823:Snx9 UTSW 17 5920671 missense probably damaging 1.00
R1914:Snx9 UTSW 17 5928256 missense possibly damaging 0.65
R3703:Snx9 UTSW 17 5928200 splice site probably null
R3871:Snx9 UTSW 17 5891781 missense probably benign 0.00
R4375:Snx9 UTSW 17 5908626 nonsense probably null
R4412:Snx9 UTSW 17 5908394 missense probably damaging 0.96
R4669:Snx9 UTSW 17 5927224 missense probably damaging 1.00
R4974:Snx9 UTSW 17 5902519 splice site probably null
R5038:Snx9 UTSW 17 5887073 missense probably benign 0.12
R5137:Snx9 UTSW 17 5928253 missense probably damaging 1.00
R5369:Snx9 UTSW 17 5920580 missense probably damaging 1.00
R5459:Snx9 UTSW 17 5920638 missense probably damaging 0.99
R5624:Snx9 UTSW 17 5891809 nonsense probably null
R5847:Snx9 UTSW 17 5924621 missense possibly damaging 0.94
R5953:Snx9 UTSW 17 5908402 missense probably damaging 1.00
R5953:Snx9 UTSW 17 5908403 missense probably damaging 1.00
R6263:Snx9 UTSW 17 5887049 missense probably damaging 0.98
R6481:Snx9 UTSW 17 5922209 critical splice donor site probably null
R7873:Snx9 UTSW 17 5918476 missense possibly damaging 0.81
R7956:Snx9 UTSW 17 5918476 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGAGATGTGCCTGAGTCTGTCC -3'
(R):5'- ATGGAGCCTAACCTGCTGAG -3'

Sequencing Primer
(F):5'- CTCCTAAGAAGTATCCGTGGCTATG -3'
(R):5'- CTGAGGCAGGCGAGATGC -3'
Posted On2018-06-06