Incidental Mutation 'R6491:Ppp2r5d'
ID522903
Institutional Source Beutler Lab
Gene Symbol Ppp2r5d
Ensembl Gene ENSMUSG00000059409
Gene Nameprotein phosphatase 2, regulatory subunit B', delta
SynonymsTEG-271, B'delta, Tex271
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R6491 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location46682991-46705002 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46685583 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 388 (F388S)
Ref Sequence ENSEMBL: ENSMUSP00000002839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002839] [ENSMUST00000002845] [ENSMUST00000071841] [ENSMUST00000165007]
Predicted Effect probably damaging
Transcript: ENSMUST00000002839
AA Change: F388S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002839
Gene: ENSMUSG00000059409
AA Change: F388S

DomainStartEndE-ValueType
low complexity region 37 59 N/A INTRINSIC
Pfam:B56 95 505 6.2e-201 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000002845
SMART Domains Protein: ENSMUSP00000002845
Gene: ENSMUSG00000002768

DomainStartEndE-ValueType
Pfam:MEA1 1 174 1.6e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071841
SMART Domains Protein: ENSMUSP00000071743
Gene: ENSMUSG00000063576

DomainStartEndE-ValueType
Pfam:Kelch_1 13 63 1.6e-8 PFAM
Pfam:Kelch_2 13 63 2.2e-9 PFAM
Pfam:Kelch_4 13 65 3.8e-8 PFAM
Pfam:Kelch_6 13 67 9.6e-11 PFAM
Pfam:Kelch_5 73 113 3.1e-8 PFAM
Pfam:Kelch_1 76 117 1.9e-7 PFAM
Pfam:Kelch_6 76 121 1.7e-9 PFAM
Pfam:Kelch_2 77 121 2.1e-8 PFAM
Pfam:Kelch_4 77 125 4.6e-11 PFAM
Pfam:Kelch_3 86 136 1.3e-12 PFAM
Pfam:Kelch_1 127 172 1.5e-10 PFAM
Pfam:Kelch_6 127 173 2e-10 PFAM
Pfam:Kelch_2 127 174 4.7e-14 PFAM
Pfam:Kelch_4 127 177 1.3e-10 PFAM
Pfam:Kelch_2 179 231 2.4e-8 PFAM
Pfam:Kelch_1 180 233 5.8e-9 PFAM
Pfam:Kelch_3 189 247 7.3e-8 PFAM
Pfam:Kelch_5 235 276 1.2e-11 PFAM
Pfam:Kelch_1 238 284 2.7e-8 PFAM
Pfam:Kelch_6 238 293 2.4e-12 PFAM
Pfam:Kelch_3 248 299 4.2e-10 PFAM
low complexity region 322 333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165007
SMART Domains Protein: ENSMUSP00000128271
Gene: ENSMUSG00000063576

DomainStartEndE-ValueType
Pfam:Kelch_1 13 63 9.9e-10 PFAM
Pfam:Kelch_2 13 63 2.2e-9 PFAM
Pfam:Kelch_6 13 66 7.5e-11 PFAM
Pfam:Kelch_4 13 71 1.4e-8 PFAM
Pfam:Kelch_5 73 113 3e-8 PFAM
Pfam:Kelch_1 76 118 2.6e-8 PFAM
Pfam:Kelch_6 76 121 1.1e-10 PFAM
Pfam:Kelch_4 76 126 2e-11 PFAM
Pfam:Kelch_2 77 121 2.1e-8 PFAM
Pfam:Kelch_3 86 136 7.7e-12 PFAM
Pfam:Kelch_1 127 170 1.2e-8 PFAM
Pfam:Kelch_2 127 174 4.7e-14 PFAM
Pfam:Kelch_4 127 177 1.7e-7 PFAM
Pfam:Kelch_2 179 231 2.4e-8 PFAM
Pfam:Kelch_6 179 239 2.5e-9 PFAM
Pfam:Kelch_1 180 232 3.4e-8 PFAM
Pfam:Kelch_3 189 247 5.7e-8 PFAM
Pfam:Kelch_5 235 276 4.3e-10 PFAM
Pfam:Kelch_1 238 285 9.3e-10 PFAM
Pfam:Kelch_4 238 291 9.9e-8 PFAM
Pfam:Kelch_6 238 293 2.5e-12 PFAM
Pfam:Kelch_3 248 299 1.1e-9 PFAM
low complexity region 322 333 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a delta isoform of the regulatory subunit B56 subfamily. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trap allele exhibit lethality, while heterozygous mice display decreased prepulse inhibition. Mice homozygous for a targeted knock-out allele exhibit decreased thermal nociception threshold, impaired coordination, and increasedlatency to removing an adhesive sticker. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,475,972 L431P probably damaging Het
Acad10 A C 5: 121,630,157 W779G probably damaging Het
Acrbp A G 6: 125,051,479 probably benign Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
Ap2a1 A T 7: 44,916,164 I93K probably damaging Het
Arnt T A 3: 95,476,143 M240K probably damaging Het
Ceacam12 A T 7: 18,069,260 K197M probably damaging Het
Cep41 T C 6: 30,656,484 N323S probably benign Het
Dst A G 1: 34,193,012 T2904A probably benign Het
Eml1 G A 12: 108,513,071 probably null Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Irf2bpl A G 12: 86,883,464 V145A probably benign Het
Itga2b T C 11: 102,459,869 probably null Het
Itga8 T C 2: 12,204,776 D466G probably damaging Het
Kdm4c G T 4: 74,373,636 C830F probably damaging Het
Mrps27 T C 13: 99,363,030 S73P probably damaging Het
Mtdh T G 15: 34,116,327 N17K probably damaging Het
Muc3a A G 5: 137,212,128 S9P probably benign Het
Olfr910 A G 9: 38,647,455 L23P probably damaging Het
Oxgr1 T A 14: 120,022,007 I263F probably benign Het
Phc1 A G 6: 122,334,964 Het
Pxmp4 A G 2: 154,592,163 probably null Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror1 A G 4: 100,409,912 N270S possibly damaging Het
Slc7a14 T C 3: 31,223,944 Y504C probably damaging Het
Snx9 A G 17: 5,920,162 D391G probably benign Het
St18 T A 1: 6,827,985 Y670* probably null Het
Tjp1 A T 7: 65,337,117 F207I possibly damaging Het
Trappc3 A G 4: 126,275,229 I171V probably benign Het
Ugt2b5 A T 5: 87,125,469 L446* probably null Het
Vmn2r105 A T 17: 20,227,730 Y277* probably null Het
Vmn2r11 A T 5: 109,048,934 N557K possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp938 A G 10: 82,227,529 *65Q probably null Het
Other mutations in Ppp2r5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Ppp2r5d APN 17 46685517 critical splice donor site probably null
IGL01570:Ppp2r5d APN 17 46687917 missense possibly damaging 0.64
IGL02504:Ppp2r5d APN 17 46700093 missense probably benign 0.34
R0620:Ppp2r5d UTSW 17 46684018 missense probably benign
R0665:Ppp2r5d UTSW 17 46686404 missense probably damaging 1.00
R1584:Ppp2r5d UTSW 17 46684684 missense probably benign 0.45
R1989:Ppp2r5d UTSW 17 46684099 missense probably benign 0.00
R4261:Ppp2r5d UTSW 17 46687081 nonsense probably null
R5577:Ppp2r5d UTSW 17 46687975 missense probably benign 0.00
R5717:Ppp2r5d UTSW 17 46687894 missense probably damaging 0.99
R6266:Ppp2r5d UTSW 17 46685703 splice site probably null
R6792:Ppp2r5d UTSW 17 46704856 missense probably benign
R7060:Ppp2r5d UTSW 17 46687353 missense possibly damaging 0.63
R7100:Ppp2r5d UTSW 17 46685682 missense probably benign 0.03
R7197:Ppp2r5d UTSW 17 46685601 missense probably damaging 0.99
R7231:Ppp2r5d UTSW 17 46684060 missense probably benign 0.00
R7237:Ppp2r5d UTSW 17 46686280 missense possibly damaging 0.86
R7420:Ppp2r5d UTSW 17 46687581 missense probably null 1.00
R7832:Ppp2r5d UTSW 17 46684546 missense probably benign 0.00
R7915:Ppp2r5d UTSW 17 46684546 missense probably benign 0.00
R8129:Ppp2r5d UTSW 17 46684337 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCATTGTTCCAGTAGTAGAGGGC -3'
(R):5'- TCCAAGCCAGAGAAGCCATG -3'

Sequencing Primer
(F):5'- AGTAGTAGAGGGCGCGCTC -3'
(R):5'- CCATGCAGTGGCTGAGGGTAG -3'
Posted On2018-06-06