Incidental Mutation 'R6494:Olfr1117-ps1'
ID 522914
Institutional Source Beutler Lab
Gene Symbol Olfr1117-ps1
Ensembl Gene ENSMUSG00000083706
Gene Name olfactory receptor 1117, pseudogene 1
Synonyms GA_x6K02T2Q125-48769330-48770299, MOR264-27_p, MOR264-10P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock # R6494 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 87284352-87285272 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 87309176 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 149 (N149I)
Ref Sequence ENSEMBL: ENSMUSP00000150394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121296] [ENSMUST00000216396]
AlphaFold A0A1L1STN9
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120328
Predicted Effect probably benign
Transcript: ENSMUST00000121296
AA Change: N129I

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144143
Gene: ENSMUSG00000083706
AA Change: N129I

DomainStartEndE-ValueType
Pfam:7tm_4 22 298 1.2e-51 PFAM
Pfam:7tm_1 32 281 7.2e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216396
AA Change: N149I

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,924 N419S possibly damaging Het
Akt2 T C 7: 27,616,349 L52P possibly damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chic2 T C 5: 75,044,282 E6G probably benign Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Col5a2 C A 1: 45,378,327 D1363Y probably damaging Het
Csmd1 C T 8: 16,211,695 probably null Het
Dnah7b A T 1: 46,099,431 Y211F probably damaging Het
Efcab3 A T 11: 105,100,019 Y5460F possibly damaging Het
Efcab6 T A 15: 84,044,322 probably null Het
Eno4 T A 19: 58,962,794 Y237N probably damaging Het
Fer1l4 T A 2: 156,045,470 D602V probably benign Het
Fgfr2 T C 7: 130,198,550 N337S probably damaging Het
Fras1 C T 5: 96,759,564 R3203C possibly damaging Het
Gbp2 T A 3: 142,632,008 V295E probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Hyal4 A G 6: 24,765,746 I366M possibly damaging Het
Itsn2 C T 12: 4,634,792 R448* probably null Het
Klhl35 G T 7: 99,472,899 W69L probably damaging Het
Kpnb1 T C 11: 97,181,648 I154V probably benign Het
Lax1 T A 1: 133,680,448 Y185F probably damaging Het
Mmp12 C T 9: 7,353,479 P208L probably damaging Het
Ndufb8 C T 19: 44,555,305 V33M probably null Het
Nptn T G 9: 58,623,752 C169G probably damaging Het
Nuggc A T 14: 65,648,222 E766V probably damaging Het
Olfr1150-ps1 A T 2: 87,357,632 K63* probably null Het
Pcdhga6 T A 18: 37,708,541 I438N probably damaging Het
Pkn2 T C 3: 142,803,668 N721S possibly damaging Het
Pole T C 5: 110,324,722 W1590R possibly damaging Het
Prph2 A G 17: 46,911,081 T129A probably benign Het
Ptpro A T 6: 137,382,642 K403N probably benign Het
Rbck1 T C 2: 152,330,966 D54G possibly damaging Het
Serpinb7 T A 1: 107,435,346 L80* probably null Het
Setdb2 T A 14: 59,402,414 Y676F probably benign Het
Skint1 G T 4: 112,010,712 C12F probably benign Het
Slc22a26 T A 19: 7,802,286 D55V probably damaging Het
Slc9a8 G A 2: 167,424,291 V63I probably damaging Het
Sox2 T A 3: 34,651,097 S228T probably benign Het
Spg11 A G 2: 122,113,225 S149P probably damaging Het
Tbc1d19 T A 5: 53,829,383 S45T probably benign Het
Tsacc T C 3: 88,295,396 E11G probably benign Het
Ttc7b C T 12: 100,495,407 A104T possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp108 T A 7: 24,261,357 F458I probably damaging Het
Zfp616 A T 11: 74,085,192 K762N probably damaging Het
Other mutations in Olfr1117-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6154:Olfr1117-ps1 UTSW 2 87309558 missense probably benign 0.01
R6464:Olfr1117-ps1 UTSW 2 87309607 missense probably damaging 0.97
R6692:Olfr1117-ps1 UTSW 2 87308992 missense possibly damaging 0.95
R6826:Olfr1117-ps1 UTSW 2 87284328 missense probably benign 0.02
R7054:Olfr1117-ps1 UTSW 2 87284431 missense probably benign 0.42
R7176:Olfr1117-ps1 UTSW 2 87285034 missense probably damaging 0.99
R7271:Olfr1117-ps1 UTSW 2 87284381 missense probably benign 0.23
R7616:Olfr1117-ps1 UTSW 2 87285273 makesense probably null
R8434:Olfr1117-ps1 UTSW 2 87284634 missense probably benign 0.01
R8673:Olfr1117-ps1 UTSW 2 87284314 missense probably benign 0.05
R8733:Olfr1117-ps1 UTSW 2 87284772 missense probably benign 0.24
R8981:Olfr1117-ps1 UTSW 2 87285217 missense probably benign 0.01
R9567:Olfr1117-ps1 UTSW 2 87284693 nonsense probably null
R9654:Olfr1117-ps1 UTSW 2 87284727 missense probably benign 0.12
R9716:Olfr1117-ps1 UTSW 2 87285147 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTACTATTCCAAGAATGCTTATGG -3'
(R):5'- AAGCCTTGGCCATCCCTTTG -3'

Sequencing Primer
(F):5'- ACAGAGTGCCTCTTGCT -3'
(R):5'- ATCCCTTTGGCTGAAGACAG -3'
Posted On 2018-06-06