Incidental Mutation 'R6494:Slc9a8'
ID522924
Institutional Source Beutler Lab
Gene Symbol Slc9a8
Ensembl Gene ENSMUSG00000039463
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 8
Synonyms1200006P13Rik, 6430709P13Rik, NHE8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6494 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location167421712-167477000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 167424291 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 63 (V63I)
Ref Sequence ENSEMBL: ENSMUSP00000104841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047815] [ENSMUST00000073873] [ENSMUST00000109218]
Predicted Effect probably benign
Transcript: ENSMUST00000047815
AA Change: V63I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000044185
Gene: ENSMUSG00000039463
AA Change: V63I

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 57 468 3.3e-69 PFAM
low complexity region 497 513 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073873
AA Change: V63I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000073536
Gene: ENSMUSG00000039463
AA Change: V63I

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 441 3.5e-62 PFAM
low complexity region 470 486 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109218
AA Change: V63I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104841
Gene: ENSMUSG00000039463
AA Change: V63I

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 437 3.7e-61 PFAM
low complexity region 466 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150326
Meta Mutation Damage Score 0.2325 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: This gene encodes a member of the Na+/H+ exchanger (NHE) family of integral membrane transporter proteins. The encoded protein is expressed on the apical membrane of the intestinal epithelial cells and plays an important role in mucosal protection. Loss of the encoded protein in mice results in a decrease in the number of goblet and mucin-positive cells, disorganization of the mucin layer, and a decrease in mucosal pH in the colon. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility, impaired mucin synthesis and bicarbonate secretion in the colon, abnormal blood coagulation and increased length of the small intestine, cecum and ileum crypts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,924 N419S possibly damaging Het
Akt2 T C 7: 27,616,349 L52P possibly damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chic2 T C 5: 75,044,282 E6G probably benign Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Col5a2 C A 1: 45,378,327 D1363Y probably damaging Het
Csmd1 C T 8: 16,211,695 probably null Het
Dnah7b A T 1: 46,099,431 Y211F probably damaging Het
Efcab3 A T 11: 105,100,019 Y5460F possibly damaging Het
Efcab6 T A 15: 84,044,322 probably null Het
Eno4 T A 19: 58,962,794 Y237N probably damaging Het
Fer1l4 T A 2: 156,045,470 D602V probably benign Het
Fgfr2 T C 7: 130,198,550 N337S probably damaging Het
Fras1 C T 5: 96,759,564 R3203C possibly damaging Het
Gbp2 T A 3: 142,632,008 V295E probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Hyal4 A G 6: 24,765,746 I366M possibly damaging Het
Itsn2 C T 12: 4,634,792 R448* probably null Het
Klhl35 G T 7: 99,472,899 W69L probably damaging Het
Kpnb1 T C 11: 97,181,648 I154V probably benign Het
Lax1 T A 1: 133,680,448 Y185F probably damaging Het
Mmp12 C T 9: 7,353,479 P208L probably damaging Het
Ndufb8 C T 19: 44,555,305 V33M probably null Het
Nptn T G 9: 58,623,752 C169G probably damaging Het
Nuggc A T 14: 65,648,222 E766V probably damaging Het
Olfr1117-ps1 A T 2: 87,309,176 N149I possibly damaging Het
Olfr1150-ps1 A T 2: 87,357,632 K63* probably null Het
Pcdhga6 T A 18: 37,708,541 I438N probably damaging Het
Pkn2 T C 3: 142,803,668 N721S possibly damaging Het
Pole T C 5: 110,324,722 W1590R possibly damaging Het
Prph2 A G 17: 46,911,081 T129A probably benign Het
Ptpro A T 6: 137,382,642 K403N probably benign Het
Rbck1 T C 2: 152,330,966 D54G possibly damaging Het
Serpinb7 T A 1: 107,435,346 L80* probably null Het
Setdb2 T A 14: 59,402,414 Y676F probably benign Het
Skint1 G T 4: 112,010,712 C12F probably benign Het
Slc22a26 T A 19: 7,802,286 D55V probably damaging Het
Sox2 T A 3: 34,651,097 S228T probably benign Het
Spg11 A G 2: 122,113,225 S149P probably damaging Het
Tbc1d19 T A 5: 53,829,383 S45T probably benign Het
Tsacc T C 3: 88,295,396 E11G probably benign Het
Ttc7b C T 12: 100,495,407 A104T possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp108 T A 7: 24,261,357 F458I probably damaging Het
Zfp616 A T 11: 74,085,192 K762N probably damaging Het
Other mutations in Slc9a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Slc9a8 APN 2 167424166 missense possibly damaging 0.46
IGL02626:Slc9a8 APN 2 167467677 splice site probably benign
costello UTSW 2 167451296 missense probably damaging 1.00
R0270:Slc9a8 UTSW 2 167451296 missense probably damaging 1.00
R0417:Slc9a8 UTSW 2 167457344 missense probably benign 0.00
R0504:Slc9a8 UTSW 2 167424205 missense probably benign
R0906:Slc9a8 UTSW 2 167434867 intron probably benign
R1216:Slc9a8 UTSW 2 167424121 missense probably benign 0.00
R1225:Slc9a8 UTSW 2 167471523 missense probably benign 0.20
R1604:Slc9a8 UTSW 2 167471432 missense probably benign 0.09
R1728:Slc9a8 UTSW 2 167424145 missense probably benign 0.00
R1729:Slc9a8 UTSW 2 167424145 missense probably benign 0.00
R1773:Slc9a8 UTSW 2 167471465 missense possibly damaging 0.57
R1775:Slc9a8 UTSW 2 167457358 missense probably benign 0.12
R1918:Slc9a8 UTSW 2 167424214 missense possibly damaging 0.95
R2312:Slc9a8 UTSW 2 167451276 missense probably benign 0.01
R3031:Slc9a8 UTSW 2 167451281 missense probably damaging 1.00
R3752:Slc9a8 UTSW 2 167457352 missense probably benign
R3757:Slc9a8 UTSW 2 167424130 missense probably benign 0.01
R4499:Slc9a8 UTSW 2 167424193 missense probably benign 0.01
R4746:Slc9a8 UTSW 2 167441170 nonsense probably null
R4904:Slc9a8 UTSW 2 167471396 missense possibly damaging 0.51
R4969:Slc9a8 UTSW 2 167446529 missense probably benign 0.06
R5395:Slc9a8 UTSW 2 167467722 missense probably damaging 0.99
R5811:Slc9a8 UTSW 2 167471387 nonsense probably null
R5908:Slc9a8 UTSW 2 167451170 intron probably benign
R6311:Slc9a8 UTSW 2 167451220 missense probably damaging 1.00
R6443:Slc9a8 UTSW 2 167434821 missense probably benign 0.00
R7161:Slc9a8 UTSW 2 167465383 missense possibly damaging 0.90
R7322:Slc9a8 UTSW 2 167451302 missense probably damaging 1.00
R7354:Slc9a8 UTSW 2 167474131 missense possibly damaging 0.93
R7896:Slc9a8 UTSW 2 167465358 missense probably benign 0.07
R8095:Slc9a8 UTSW 2 167468971 missense probably damaging 0.99
R8725:Slc9a8 UTSW 2 167473534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGCCGCATGTATATCTATCTCC -3'
(R):5'- AATGCGACTTCAAGCACACG -3'

Sequencing Primer
(F):5'- GCATGTATATCTATCTCCCAACAGG -3'
(R):5'- AGCTCTTTCTAGGCCAGGCAATG -3'
Posted On2018-06-06