Incidental Mutation 'R6494:Sox2'
ID522926
Institutional Source Beutler Lab
Gene Symbol Sox2
Ensembl Gene ENSMUSG00000074637
Gene NameSRY (sex determining region Y)-box 2
Synonymsysb, Sox-2, lcc
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6494 (G1)
Quality Score220.009
Status Validated
Chromosome3
Chromosomal Location34650405-34652461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34651097 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 228 (S228T)
Ref Sequence ENSEMBL: ENSMUSP00000096755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099151]
Predicted Effect probably benign
Transcript: ENSMUST00000099151
AA Change: S228T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000096755
Gene: ENSMUSG00000074637
AA Change: S228T

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
HMG 42 112 1.8e-28 SMART
low complexity region 137 156 N/A INTRINSIC
low complexity region 248 263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200414
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: This intronless gene encodes a member of the SRY-related HMG-box (SOX) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The product of this gene is required for stem-cell maintenance in the central nervous system, and also regulates gene expression in the stomach. Mutations in a similar gene in human have been associated with optic nerve hypoplasia and with syndromic microphthalmia, a severe form of structural eye malformation. This gene lies within an intron of another gene called SOX2 overlapping transcript (Sox2ot). [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations implant but fail to develop an egg cylinder or epiblast, and die shortly thereafter. Other mutations that affect only regulatory elements show circling behavior and deafness, inner ear defects, and a yellow coat color. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,924 N419S possibly damaging Het
Akt2 T C 7: 27,616,349 L52P possibly damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chic2 T C 5: 75,044,282 E6G probably benign Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Col5a2 C A 1: 45,378,327 D1363Y probably damaging Het
Csmd1 C T 8: 16,211,695 probably null Het
Dnah7b A T 1: 46,099,431 Y211F probably damaging Het
Efcab3 A T 11: 105,100,019 Y5460F possibly damaging Het
Efcab6 T A 15: 84,044,322 probably null Het
Eno4 T A 19: 58,962,794 Y237N probably damaging Het
Fer1l4 T A 2: 156,045,470 D602V probably benign Het
Fgfr2 T C 7: 130,198,550 N337S probably damaging Het
Fras1 C T 5: 96,759,564 R3203C possibly damaging Het
Gbp2 T A 3: 142,632,008 V295E probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Hyal4 A G 6: 24,765,746 I366M possibly damaging Het
Itsn2 C T 12: 4,634,792 R448* probably null Het
Klhl35 G T 7: 99,472,899 W69L probably damaging Het
Kpnb1 T C 11: 97,181,648 I154V probably benign Het
Lax1 T A 1: 133,680,448 Y185F probably damaging Het
Mmp12 C T 9: 7,353,479 P208L probably damaging Het
Ndufb8 C T 19: 44,555,305 V33M probably null Het
Nptn T G 9: 58,623,752 C169G probably damaging Het
Nuggc A T 14: 65,648,222 E766V probably damaging Het
Olfr1117-ps1 A T 2: 87,309,176 N149I possibly damaging Het
Olfr1150-ps1 A T 2: 87,357,632 K63* probably null Het
Pcdhga6 T A 18: 37,708,541 I438N probably damaging Het
Pkn2 T C 3: 142,803,668 N721S possibly damaging Het
Pole T C 5: 110,324,722 W1590R possibly damaging Het
Prph2 A G 17: 46,911,081 T129A probably benign Het
Ptpro A T 6: 137,382,642 K403N probably benign Het
Rbck1 T C 2: 152,330,966 D54G possibly damaging Het
Serpinb7 T A 1: 107,435,346 L80* probably null Het
Setdb2 T A 14: 59,402,414 Y676F probably benign Het
Skint1 G T 4: 112,010,712 C12F probably benign Het
Slc22a26 T A 19: 7,802,286 D55V probably damaging Het
Slc9a8 G A 2: 167,424,291 V63I probably damaging Het
Spg11 A G 2: 122,113,225 S149P probably damaging Het
Tbc1d19 T A 5: 53,829,383 S45T probably benign Het
Tsacc T C 3: 88,295,396 E11G probably benign Het
Ttc7b C T 12: 100,495,407 A104T possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp108 T A 7: 24,261,357 F458I probably damaging Het
Zfp616 A T 11: 74,085,192 K762N probably damaging Het
Other mutations in Sox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02578:Sox2 APN 3 34650596 missense probably benign 0.37
IGL03397:Sox2 APN 3 34650537 missense probably damaging 0.99
R1164:Sox2 UTSW 3 34650699 missense probably damaging 1.00
R1667:Sox2 UTSW 3 34650419 missense probably damaging 1.00
R1829:Sox2 UTSW 3 34650741 missense probably damaging 0.99
R1925:Sox2 UTSW 3 34650671 nonsense probably null
R2066:Sox2 UTSW 3 34651307 missense possibly damaging 0.63
R4170:Sox2 UTSW 3 34650554 missense probably damaging 0.99
R4585:Sox2 UTSW 3 34651044 missense probably benign 0.02
R4586:Sox2 UTSW 3 34651044 missense probably benign 0.02
R4703:Sox2 UTSW 3 34650713 missense probably damaging 1.00
R5509:Sox2 UTSW 3 34650789 missense probably damaging 0.98
R5549:Sox2 UTSW 3 34650993 missense probably benign 0.01
R5637:Sox2 UTSW 3 34650528 missense probably benign 0.03
R7117:Sox2 UTSW 3 34650926 missense possibly damaging 0.95
R7210:Sox2 UTSW 3 34651157 missense probably damaging 1.00
R7365:Sox2 UTSW 3 34650972 missense possibly damaging 0.60
R7798:Sox2 UTSW 3 34650642 missense probably damaging 0.96
R7801:Sox2 UTSW 3 34650642 missense probably damaging 0.96
R8684:Sox2 UTSW 3 34650867 missense probably benign 0.00
X0024:Sox2 UTSW 3 34650689 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAAGTACACGCTTCCCGGAG -3'
(R):5'- TTCTCCAGTTCGCAGTCCAG -3'

Sequencing Primer
(F):5'- TACGCGCACATGAACGG -3'
(R):5'- TGGGCCATGTGCAGTCTAC -3'
Posted On2018-06-06