Incidental Mutation 'R6492:Mc3r'
ID522935
Institutional Source Beutler Lab
Gene Symbol Mc3r
Ensembl Gene ENSMUSG00000038537
Gene Namemelanocortin 3 receptor
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R6492 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location172248492-172251114 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 172249154 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 99 (A99T)
Ref Sequence ENSEMBL: ENSMUSP00000047358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038532]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038532
AA Change: A99T

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047358
Gene: ENSMUSG00000038537
AA Change: A99T

DomainStartEndE-ValueType
Pfam:7tm_4 45 198 3.2e-12 PFAM
Pfam:7TM_GPCR_Srsx 49 314 1.9e-7 PFAM
Pfam:7tm_1 55 299 5.4e-35 PFAM
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene encodes a member of the melanocortin receptor family. Melanocortin receptors are transmembrane G-protein coupled receptors, which respond to small peptide hormones and exhibit diverse functions and tissue type localization. As part of the central nervous melanocortin system, the encoded protein is competitively bound by either melanocyte stimulating hormone or agouti-related protein to regulate energy homeostasis and adaptation to food restriction. Disruption of this gene results in an increased ratio of weight gain to food intake, increased fat mass, and decreased lean mass, without having a large effect on insulin sensitivity or glucose metabolism. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygotes for a null allele exhibit obesity, increased respiratory quotient on a high fat diet, and reduced energy expenditure. Homozygotes for another null allele show reduced lean mass, increased fat mass, diet-induced obesity, increased insulin and leptin levels, and reduced energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,654,505 T587I probably benign Het
Abl1 T A 2: 31,801,655 M1062K probably benign Het
Agbl4 G A 4: 111,547,272 D272N probably damaging Het
Apob A T 12: 8,008,261 I2215F probably damaging Het
Atp10b A T 11: 43,218,957 Q821H probably damaging Het
Atp1a3 T C 7: 24,979,304 Y971C probably damaging Het
Atp6ap1l A T 13: 90,883,722 H280Q probably damaging Het
B4galt2 A T 4: 117,876,967 M291K probably damaging Het
Cachd1 G T 4: 100,952,118 V267F possibly damaging Het
Cadm2 G T 16: 66,784,828 L188M probably damaging Het
Ceacam19 T C 7: 19,882,592 N199S probably benign Het
Chrna5 A G 9: 54,998,063 D53G probably benign Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Cluap1 T A 16: 3,928,612 M279K probably benign Het
Cngb1 T A 8: 95,264,424 M717L probably benign Het
Cp T C 3: 19,982,022 V777A probably benign Het
Drosha A G 15: 12,861,706 D594G probably benign Het
Exo5 A G 4: 120,921,537 probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gprc5b A G 7: 118,984,577 I23T possibly damaging Het
Ikbke T C 1: 131,259,218 Y579C probably damaging Het
Ikzf2 T C 1: 69,539,042 Y362C probably damaging Het
Itfg1 A G 8: 85,740,349 V365A probably benign Het
Josd2 T C 7: 44,471,154 I105T probably damaging Het
Mettl22 T A 16: 8,488,891 probably null Het
Mgat5 A G 1: 127,471,564 I619V probably benign Het
Nin T C 12: 70,054,534 I430V probably benign Het
Olfr1047 T A 2: 86,228,387 I195F possibly damaging Het
Olfr1052 T C 2: 86,298,646 F277L probably benign Het
Olfr153 C G 2: 87,532,741 A236G possibly damaging Het
Olfr221 A G 14: 52,035,445 F222S probably benign Het
Olfr668 C A 7: 104,925,645 A40S possibly damaging Het
Parvb T C 15: 84,303,872 L272P probably damaging Het
Pde2a A G 7: 101,500,442 K180E possibly damaging Het
Pik3c3 C T 18: 30,324,562 T736M probably damaging Het
Plcb4 C T 2: 135,973,071 R760* probably null Het
Pramel6 C T 2: 87,510,422 T366I probably benign Het
Prr29 C T 11: 106,375,236 R42W probably damaging Het
Prss12 A G 3: 123,447,399 I81V probably benign Het
Ptpn13 A G 5: 103,501,612 T294A probably benign Het
Ptprc A T 1: 138,113,562 probably null Het
Sin3b T A 8: 72,733,490 probably null Het
Slco5a1 T C 1: 12,989,927 Y190C probably damaging Het
Slco6c1 T G 1: 97,125,813 Y121S probably damaging Het
Srcap G T 7: 127,522,145 G217* probably null Het
Ss18 A T 18: 14,651,088 M181K probably damaging Het
Synm T C 7: 67,736,061 T176A probably benign Het
Taf3 T C 2: 9,951,160 E579G probably damaging Het
Taf7 A G 18: 37,643,106 I136T probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Tyrp1 A G 4: 80,840,781 D297G probably null Het
Uox C T 3: 146,624,577 R163* probably null Het
Wisp3 C T 10: 39,154,987 G180D probably benign Het
Wwp1 G A 4: 19,650,299 S289L possibly damaging Het
Xbp1 T C 11: 5,521,005 V4A probably benign Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb2 T C 10: 4,369,711 Y105C probably damaging Het
Zeb2 T C 2: 45,110,496 probably benign Het
Zkscan8 A T 13: 21,525,227 I167N probably benign Het
Other mutations in Mc3r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Mc3r APN 2 172249028 missense possibly damaging 0.95
IGL01618:Mc3r APN 2 172249370 missense probably benign
IGL01784:Mc3r APN 2 172249370 missense probably benign
IGL01865:Mc3r APN 2 172249055 missense probably damaging 1.00
IGL02164:Mc3r APN 2 172249394 missense probably damaging 1.00
IGL03011:Mc3r APN 2 172249796 missense probably benign 0.08
IGL03266:Mc3r APN 2 172249269 missense probably benign 0.01
R0882:Mc3r UTSW 2 172249791 missense probably benign 0.00
R1005:Mc3r UTSW 2 172249563 missense probably benign 0.00
R1501:Mc3r UTSW 2 172249380 missense probably benign 0.19
R2374:Mc3r UTSW 2 172249154 missense possibly damaging 0.84
R3437:Mc3r UTSW 2 172249668 missense probably benign 0.23
R3813:Mc3r UTSW 2 172248879 missense probably benign 0.06
R3936:Mc3r UTSW 2 172249296 missense probably damaging 1.00
R4225:Mc3r UTSW 2 172249034 missense probably damaging 1.00
R4491:Mc3r UTSW 2 172249203 missense possibly damaging 0.50
R5074:Mc3r UTSW 2 172249613 missense possibly damaging 0.95
R5277:Mc3r UTSW 2 172249787 missense probably damaging 1.00
R5706:Mc3r UTSW 2 172249690 nonsense probably null
R5832:Mc3r UTSW 2 172249430 missense probably benign 0.01
R5865:Mc3r UTSW 2 172249672 missense possibly damaging 0.84
R5881:Mc3r UTSW 2 172249172 missense probably benign 0.22
R5905:Mc3r UTSW 2 172249209 missense probably damaging 1.00
R6028:Mc3r UTSW 2 172249209 missense probably damaging 1.00
R7037:Mc3r UTSW 2 172249634 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAGCAGGTCTTCATCAAG -3'
(R):5'- ATGACCCCGATCAAGGTGAG -3'

Sequencing Primer
(F):5'- AGGTCTTCATCAAGCCGGAG -3'
(R):5'- CCGATCAAGGTGAGGGCTTTC -3'
Posted On2018-06-06