Incidental Mutation 'R6494:Uox'
ID 522938
Institutional Source Beutler Lab
Gene Symbol Uox
Ensembl Gene ENSMUSG00000028186
Gene Name urate oxidase
Synonyms
MMRRC Submission 044626-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.449) question?
Stock # R6494 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 146302904-146337238 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 146330332 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 163 (R163*)
Ref Sequence ENSEMBL: ENSMUSP00000143418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029837] [ENSMUST00000121133] [ENSMUST00000199489]
AlphaFold P25688
Predicted Effect probably null
Transcript: ENSMUST00000029837
AA Change: R187*
SMART Domains Protein: ENSMUSP00000029837
Gene: ENSMUSG00000028186
AA Change: R187*

DomainStartEndE-ValueType
Pfam:Uricase 19 144 8.7e-25 PFAM
Pfam:Uricase 153 292 5.6e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121133
AA Change: R114*
SMART Domains Protein: ENSMUSP00000113649
Gene: ENSMUSG00000028186
AA Change: R114*

DomainStartEndE-ValueType
Pfam:Uricase 2 72 1.2e-19 PFAM
Pfam:Uricase 79 181 8.5e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000199489
AA Change: R163*
SMART Domains Protein: ENSMUSP00000143418
Gene: ENSMUSG00000028186
AA Change: R163*

DomainStartEndE-ValueType
Pfam:Uricase 1 121 8.3e-35 PFAM
Pfam:Uricase 128 228 1.8e-19 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
MGI Phenotype PHENOTYPE: Homozygous null mutants exhibit marked hyperuricemia and urate nephropathy. Most mutants die prior to four weeks of age. Homozygotes for a large paracentric inversion disrupting this same gene exhibit a similar phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 T C 7: 27,315,774 (GRCm39) L52P possibly damaging Het
Chd1l G A 3: 97,494,483 (GRCm39) A399V probably damaging Het
Chic2 T C 5: 75,204,943 (GRCm39) E6G probably benign Het
Clca4a T A 3: 144,663,059 (GRCm39) T597S probably benign Het
Col5a2 C A 1: 45,417,487 (GRCm39) D1363Y probably damaging Het
Csmd1 C T 8: 16,261,709 (GRCm39) probably null Het
Dnah7b A T 1: 46,138,591 (GRCm39) Y211F probably damaging Het
Efcab3 A T 11: 104,990,845 (GRCm39) Y5460F possibly damaging Het
Efcab6 T A 15: 83,928,523 (GRCm39) probably null Het
Eno4 T A 19: 58,951,226 (GRCm39) Y237N probably damaging Het
Fer1l4 T A 2: 155,887,390 (GRCm39) D602V probably benign Het
Fgfr2 T C 7: 129,800,280 (GRCm39) N337S probably damaging Het
Fras1 C T 5: 96,907,423 (GRCm39) R3203C possibly damaging Het
Gbp2 T A 3: 142,337,769 (GRCm39) V295E probably damaging Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Hyal4 A G 6: 24,765,745 (GRCm39) I366M possibly damaging Het
Itsn2 C T 12: 4,684,792 (GRCm39) R448* probably null Het
Klhl35 G T 7: 99,122,106 (GRCm39) W69L probably damaging Het
Kpnb1 T C 11: 97,072,474 (GRCm39) I154V probably benign Het
Lax1 T A 1: 133,608,186 (GRCm39) Y185F probably damaging Het
Mmp12 C T 9: 7,353,479 (GRCm39) P208L probably damaging Het
Ndufb8 C T 19: 44,543,744 (GRCm39) V33M probably null Het
Nptn T G 9: 58,531,035 (GRCm39) C169G probably damaging Het
Nuggc A T 14: 65,885,671 (GRCm39) E766V probably damaging Het
Or10ag55-ps1 A T 2: 87,139,520 (GRCm39) N149I possibly damaging Het
Or12e14 A T 2: 87,187,976 (GRCm39) K63* probably null Het
Pcdhga6 T A 18: 37,841,594 (GRCm39) I438N probably damaging Het
Pkn2 T C 3: 142,509,429 (GRCm39) N721S possibly damaging Het
Pole T C 5: 110,472,588 (GRCm39) W1590R possibly damaging Het
Prph2 A G 17: 47,222,007 (GRCm39) T129A probably benign Het
Ptpro A T 6: 137,359,640 (GRCm39) K403N probably benign Het
Rbck1 T C 2: 152,172,886 (GRCm39) D54G possibly damaging Het
Serpinb7 T A 1: 107,363,076 (GRCm39) L80* probably null Het
Setdb2 T A 14: 59,639,863 (GRCm39) Y676F probably benign Het
Skint1 G T 4: 111,867,909 (GRCm39) C12F probably benign Het
Slc22a26 T A 19: 7,779,651 (GRCm39) D55V probably damaging Het
Slc9a8 G A 2: 167,266,211 (GRCm39) V63I probably damaging Het
Sox2 T A 3: 34,705,246 (GRCm39) S228T probably benign Het
Spata31g1 A G 4: 42,971,924 (GRCm39) N419S possibly damaging Het
Spg11 A G 2: 121,943,706 (GRCm39) S149P probably damaging Het
Tbc1d19 T A 5: 53,986,725 (GRCm39) S45T probably benign Het
Tsacc T C 3: 88,202,703 (GRCm39) E11G probably benign Het
Ttc7b C T 12: 100,461,666 (GRCm39) A104T possibly damaging Het
Zfp108 T A 7: 23,960,782 (GRCm39) F458I probably damaging Het
Zfp616 A T 11: 73,976,018 (GRCm39) K762N probably damaging Het
Other mutations in Uox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Uox APN 3 146,333,565 (GRCm39) missense probably benign 0.00
IGL00902:Uox APN 3 146,316,161 (GRCm39) missense possibly damaging 0.95
IGL02409:Uox APN 3 146,330,381 (GRCm39) missense probably benign 0.06
IGL02827:Uox APN 3 146,302,951 (GRCm39) intron probably benign
IGL02979:Uox APN 3 146,316,246 (GRCm39) splice site probably null
IGL03375:Uox APN 3 146,331,590 (GRCm39) missense probably damaging 1.00
kamloops UTSW 3 146,330,332 (GRCm39) nonsense probably null
vancouver UTSW 3 146,318,047 (GRCm39) missense probably damaging 1.00
R1350:Uox UTSW 3 146,330,330 (GRCm39) missense probably damaging 1.00
R1634:Uox UTSW 3 146,318,138 (GRCm39) nonsense probably null
R1900:Uox UTSW 3 146,316,134 (GRCm39) missense probably damaging 1.00
R2000:Uox UTSW 3 146,316,154 (GRCm39) missense possibly damaging 0.65
R2119:Uox UTSW 3 146,318,297 (GRCm39) missense probably benign 0.01
R5329:Uox UTSW 3 146,330,300 (GRCm39) missense probably damaging 1.00
R5606:Uox UTSW 3 146,316,057 (GRCm39) nonsense probably null
R6281:Uox UTSW 3 146,330,332 (GRCm39) nonsense probably null
R6327:Uox UTSW 3 146,330,332 (GRCm39) nonsense probably null
R6337:Uox UTSW 3 146,330,332 (GRCm39) nonsense probably null
R6364:Uox UTSW 3 146,330,332 (GRCm39) nonsense probably null
R6365:Uox UTSW 3 146,330,332 (GRCm39) nonsense probably null
R6369:Uox UTSW 3 146,330,332 (GRCm39) nonsense probably null
R6483:Uox UTSW 3 146,330,332 (GRCm39) nonsense probably null
R6492:Uox UTSW 3 146,330,332 (GRCm39) nonsense probably null
R6556:Uox UTSW 3 146,330,403 (GRCm39) critical splice donor site probably null
R6803:Uox UTSW 3 146,318,264 (GRCm39) missense possibly damaging 0.91
R7809:Uox UTSW 3 146,333,613 (GRCm39) nonsense probably null
R7868:Uox UTSW 3 146,316,029 (GRCm39) missense probably benign 0.01
R8131:Uox UTSW 3 146,331,589 (GRCm39) missense probably damaging 1.00
R8931:Uox UTSW 3 146,318,047 (GRCm39) missense probably damaging 1.00
R9088:Uox UTSW 3 146,330,369 (GRCm39) missense probably damaging 1.00
R9566:Uox UTSW 3 146,330,308 (GRCm39) missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AATCCATAGAGAAGGGACGCCC -3'
(R):5'- AGTCCCAAAGAACTAGGAATTTGAG -3'

Sequencing Primer
(F):5'- CCACCAGAGACAAGTGATTGGTG -3'
(R):5'- AGGAATTTGAGTTGACAGTTTCCTC -3'
Posted On 2018-06-06