Incidental Mutation 'R6494:Tbc1d19'
ID 522944
Institutional Source Beutler Lab
Gene Symbol Tbc1d19
Ensembl Gene ENSMUSG00000039178
Gene Name TBC1 domain family, member 19
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock # R6494 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 53809606-53903965 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 53829383 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 45 (S45T)
Ref Sequence ENSEMBL: ENSMUSP00000144033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037337] [ENSMUST00000201958] [ENSMUST00000202528] [ENSMUST00000202599]
AlphaFold Q8VDV7
Predicted Effect probably benign
Transcript: ENSMUST00000037337
AA Change: S45T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040585
Gene: ENSMUSG00000039178
AA Change: S45T

DomainStartEndE-ValueType
TBC 248 496 8.07e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201727
Predicted Effect probably benign
Transcript: ENSMUST00000201958
AA Change: S45T

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000202528
AA Change: S45T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000202599
AA Change: S45T

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202695
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,924 N419S possibly damaging Het
Akt2 T C 7: 27,616,349 L52P possibly damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chic2 T C 5: 75,044,282 E6G probably benign Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Col5a2 C A 1: 45,378,327 D1363Y probably damaging Het
Csmd1 C T 8: 16,211,695 probably null Het
Dnah7b A T 1: 46,099,431 Y211F probably damaging Het
Efcab3 A T 11: 105,100,019 Y5460F possibly damaging Het
Efcab6 T A 15: 84,044,322 probably null Het
Eno4 T A 19: 58,962,794 Y237N probably damaging Het
Fer1l4 T A 2: 156,045,470 D602V probably benign Het
Fgfr2 T C 7: 130,198,550 N337S probably damaging Het
Fras1 C T 5: 96,759,564 R3203C possibly damaging Het
Gbp2 T A 3: 142,632,008 V295E probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Hyal4 A G 6: 24,765,746 I366M possibly damaging Het
Itsn2 C T 12: 4,634,792 R448* probably null Het
Klhl35 G T 7: 99,472,899 W69L probably damaging Het
Kpnb1 T C 11: 97,181,648 I154V probably benign Het
Lax1 T A 1: 133,680,448 Y185F probably damaging Het
Mmp12 C T 9: 7,353,479 P208L probably damaging Het
Ndufb8 C T 19: 44,555,305 V33M probably null Het
Nptn T G 9: 58,623,752 C169G probably damaging Het
Nuggc A T 14: 65,648,222 E766V probably damaging Het
Olfr1117-ps1 A T 2: 87,309,176 N149I possibly damaging Het
Olfr1150-ps1 A T 2: 87,357,632 K63* probably null Het
Pcdhga6 T A 18: 37,708,541 I438N probably damaging Het
Pkn2 T C 3: 142,803,668 N721S possibly damaging Het
Pole T C 5: 110,324,722 W1590R possibly damaging Het
Prph2 A G 17: 46,911,081 T129A probably benign Het
Ptpro A T 6: 137,382,642 K403N probably benign Het
Rbck1 T C 2: 152,330,966 D54G possibly damaging Het
Serpinb7 T A 1: 107,435,346 L80* probably null Het
Setdb2 T A 14: 59,402,414 Y676F probably benign Het
Skint1 G T 4: 112,010,712 C12F probably benign Het
Slc22a26 T A 19: 7,802,286 D55V probably damaging Het
Slc9a8 G A 2: 167,424,291 V63I probably damaging Het
Sox2 T A 3: 34,651,097 S228T probably benign Het
Spg11 A G 2: 122,113,225 S149P probably damaging Het
Tsacc T C 3: 88,295,396 E11G probably benign Het
Ttc7b C T 12: 100,495,407 A104T possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp108 T A 7: 24,261,357 F458I probably damaging Het
Zfp616 A T 11: 74,085,192 K762N probably damaging Het
Other mutations in Tbc1d19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:Tbc1d19 APN 5 53897062 nonsense probably null
IGL01684:Tbc1d19 APN 5 53856879 missense probably benign 0.31
IGL02476:Tbc1d19 APN 5 53889413 splice site probably null
IGL02869:Tbc1d19 APN 5 53835217 missense probably benign 0.02
IGL03036:Tbc1d19 APN 5 53897047 missense probably damaging 1.00
IGL03099:Tbc1d19 APN 5 53883655 splice site probably benign
LCD18:Tbc1d19 UTSW 5 53816709 intron probably benign
R0194:Tbc1d19 UTSW 5 53860156 missense probably damaging 1.00
R1729:Tbc1d19 UTSW 5 53829372 missense probably damaging 1.00
R1776:Tbc1d19 UTSW 5 53889311 splice site probably null
R1784:Tbc1d19 UTSW 5 53829372 missense probably damaging 1.00
R1902:Tbc1d19 UTSW 5 53829353 missense probably benign 0.00
R3431:Tbc1d19 UTSW 5 53848206 unclassified probably benign
R3432:Tbc1d19 UTSW 5 53848206 unclassified probably benign
R4333:Tbc1d19 UTSW 5 53872277 missense possibly damaging 0.93
R4335:Tbc1d19 UTSW 5 53872277 missense possibly damaging 0.93
R4681:Tbc1d19 UTSW 5 53872253 missense probably damaging 1.00
R4812:Tbc1d19 UTSW 5 53809806 missense probably damaging 0.99
R5178:Tbc1d19 UTSW 5 53889325 missense possibly damaging 0.84
R5214:Tbc1d19 UTSW 5 53849841 missense probably benign 0.00
R6265:Tbc1d19 UTSW 5 53837924 missense probably benign 0.06
R6372:Tbc1d19 UTSW 5 53856910 missense possibly damaging 0.55
R6495:Tbc1d19 UTSW 5 53889213 splice site probably null
R6612:Tbc1d19 UTSW 5 53809845 missense possibly damaging 0.88
R6787:Tbc1d19 UTSW 5 53835249 splice site probably null
R6965:Tbc1d19 UTSW 5 53856924 critical splice donor site probably null
R7275:Tbc1d19 UTSW 5 53872276 missense probably damaging 1.00
R7642:Tbc1d19 UTSW 5 53856918 missense probably damaging 0.98
R7655:Tbc1d19 UTSW 5 53897035 missense probably damaging 1.00
R7656:Tbc1d19 UTSW 5 53897035 missense probably damaging 1.00
R8314:Tbc1d19 UTSW 5 53897047 missense probably damaging 1.00
R8479:Tbc1d19 UTSW 5 53883689 missense possibly damaging 0.83
X0026:Tbc1d19 UTSW 5 53835247 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCAGGCAGGTCTAAGCTGC -3'
(R):5'- GACTAATGCAAAGCAGTCCCTG -3'

Sequencing Primer
(F):5'- TCAGGCAGGTCTAAGCTGCTATAG -3'
(R):5'- ACCGTGTCCTCACATGTCAG -3'
Posted On 2018-06-06