Incidental Mutation 'R6494:Hyal4'
ID 522952
Institutional Source Beutler Lab
Gene Symbol Hyal4
Ensembl Gene ENSMUSG00000029680
Gene Name hyaluronoglucosaminidase 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6494 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 24748329-24767662 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24765746 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 366 (I366M)
Ref Sequence ENSEMBL: ENSMUSP00000031691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031691]
AlphaFold Q05A56
Predicted Effect possibly damaging
Transcript: ENSMUST00000031691
AA Change: I366M

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031691
Gene: ENSMUSG00000029680
AA Change: I366M

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Glyco_hydro_56 41 373 3e-137 PFAM
EGF 375 447 2.81e0 SMART
low complexity region 453 473 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is similar in structure to hyaluronidases. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. However, this protein has not yet been shown to have hyaluronidase activity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,924 N419S possibly damaging Het
Akt2 T C 7: 27,616,349 L52P possibly damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chic2 T C 5: 75,044,282 E6G probably benign Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Col5a2 C A 1: 45,378,327 D1363Y probably damaging Het
Csmd1 C T 8: 16,211,695 probably null Het
Dnah7b A T 1: 46,099,431 Y211F probably damaging Het
Efcab3 A T 11: 105,100,019 Y5460F possibly damaging Het
Efcab6 T A 15: 84,044,322 probably null Het
Eno4 T A 19: 58,962,794 Y237N probably damaging Het
Fer1l4 T A 2: 156,045,470 D602V probably benign Het
Fgfr2 T C 7: 130,198,550 N337S probably damaging Het
Fras1 C T 5: 96,759,564 R3203C possibly damaging Het
Gbp2 T A 3: 142,632,008 V295E probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Itsn2 C T 12: 4,634,792 R448* probably null Het
Klhl35 G T 7: 99,472,899 W69L probably damaging Het
Kpnb1 T C 11: 97,181,648 I154V probably benign Het
Lax1 T A 1: 133,680,448 Y185F probably damaging Het
Mmp12 C T 9: 7,353,479 P208L probably damaging Het
Ndufb8 C T 19: 44,555,305 V33M probably null Het
Nptn T G 9: 58,623,752 C169G probably damaging Het
Nuggc A T 14: 65,648,222 E766V probably damaging Het
Olfr1117-ps1 A T 2: 87,309,176 N149I possibly damaging Het
Olfr1150-ps1 A T 2: 87,357,632 K63* probably null Het
Pcdhga6 T A 18: 37,708,541 I438N probably damaging Het
Pkn2 T C 3: 142,803,668 N721S possibly damaging Het
Pole T C 5: 110,324,722 W1590R possibly damaging Het
Prph2 A G 17: 46,911,081 T129A probably benign Het
Ptpro A T 6: 137,382,642 K403N probably benign Het
Rbck1 T C 2: 152,330,966 D54G possibly damaging Het
Serpinb7 T A 1: 107,435,346 L80* probably null Het
Setdb2 T A 14: 59,402,414 Y676F probably benign Het
Skint1 G T 4: 112,010,712 C12F probably benign Het
Slc22a26 T A 19: 7,802,286 D55V probably damaging Het
Slc9a8 G A 2: 167,424,291 V63I probably damaging Het
Sox2 T A 3: 34,651,097 S228T probably benign Het
Spg11 A G 2: 122,113,225 S149P probably damaging Het
Tbc1d19 T A 5: 53,829,383 S45T probably benign Het
Tsacc T C 3: 88,295,396 E11G probably benign Het
Ttc7b C T 12: 100,495,407 A104T possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp108 T A 7: 24,261,357 F458I probably damaging Het
Zfp616 A T 11: 74,085,192 K762N probably damaging Het
Other mutations in Hyal4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Hyal4 APN 6 24755872 missense probably benign 0.03
IGL01791:Hyal4 APN 6 24763895 splice site probably benign
IGL02434:Hyal4 APN 6 24763858 nonsense probably null
IGL02523:Hyal4 APN 6 24765969 missense probably damaging 0.96
IGL03114:Hyal4 APN 6 24755965 missense probably benign 0.00
IGL02835:Hyal4 UTSW 6 24765715 missense probably benign 0.00
PIT4494001:Hyal4 UTSW 6 24755834 missense probably benign 0.05
R0196:Hyal4 UTSW 6 24756221 missense probably damaging 1.00
R0323:Hyal4 UTSW 6 24756194 missense probably benign 0.30
R0398:Hyal4 UTSW 6 24756671 missense probably damaging 0.97
R0946:Hyal4 UTSW 6 24755913 nonsense probably null
R0961:Hyal4 UTSW 6 24755746 utr 5 prime probably benign
R1906:Hyal4 UTSW 6 24756111 missense probably damaging 1.00
R1998:Hyal4 UTSW 6 24756311 missense probably benign 0.00
R2085:Hyal4 UTSW 6 24755750 start gained probably benign
R2483:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3622:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3623:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3624:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3712:Hyal4 UTSW 6 24756514 missense probably damaging 1.00
R4031:Hyal4 UTSW 6 24756224 missense probably damaging 1.00
R5762:Hyal4 UTSW 6 24765862 missense possibly damaging 0.93
R6177:Hyal4 UTSW 6 24766090 nonsense probably null
R6442:Hyal4 UTSW 6 24765850 missense probably benign 0.08
R6901:Hyal4 UTSW 6 24756191 missense probably damaging 0.97
R7565:Hyal4 UTSW 6 24765934 missense possibly damaging 0.77
R7973:Hyal4 UTSW 6 24755786 start codon destroyed probably null 0.99
R7977:Hyal4 UTSW 6 24763866 missense probably damaging 0.99
R7987:Hyal4 UTSW 6 24763866 missense probably damaging 0.99
R8020:Hyal4 UTSW 6 24755996 missense probably benign 0.14
R8676:Hyal4 UTSW 6 24755827 missense probably damaging 0.99
R9331:Hyal4 UTSW 6 24765867 missense probably damaging 1.00
R9573:Hyal4 UTSW 6 24756509 missense not run
Z1176:Hyal4 UTSW 6 24756628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTCCGATCTGAGACCTTTG -3'
(R):5'- TTCTCTGCCATCACAGCTAGG -3'

Sequencing Primer
(F):5'- CCGATCTGAGACCTTTGTGTTACAG -3'
(R):5'- CATCACAGCTAGGTCAGTGTCTG -3'
Posted On 2018-06-06