Mutagenetix > Incidental Mutation

Incidental Mutation 'R6494:Ptpro'

522954

Institutional Source

Beutler Lab

Gene Symbol

Ptpro

Ensembl Gene

ENSMUSG00000030223

Gene Name

protein tyrosine phosphatase, receptor type, O

Synonyms

Ptpn15, PTP-oc, GLEPP1, PTP-U2, PTP-BK, PTP-phi, D28, PTPROt

MMRRC Submission

044626-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6494 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

137252319-137463233 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 137382642 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 403 (K403N)

Ref Sequence

ENSEMBL: ENSMUSP00000127112 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167679]

AlphaFold

E9Q612

Predicted Effect

probably benign
Transcript: ENSMUST00000077115
AA Change: K403N

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223
AA Change: K403N

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	269	291	N/A	INTRINSIC
FN3	443	528	1.07e-1	SMART
FN3	540	626	7.07e-2	SMART
FN3	642	722	4.47e1	SMART
FN3	733	812	5.92e-4	SMART
transmembrane domain	831	853	N/A	INTRINSIC
transmembrane domain	890	912	N/A	INTRINSIC
PTPc	947	1207	1.43e-127	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167679
AA Change: K403N

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223
AA Change: K403N

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	269	291	N/A	INTRINSIC
FN3	443	528	1.07e-1	SMART
FN3	540	626	7.07e-2	SMART
FN3	642	722	4.47e1	SMART
FN3	733	812	5.92e-4	SMART
transmembrane domain	831	853	N/A	INTRINSIC
PTPc	919	1179	1.43e-127	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203010

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 97.8%
20x: 92.4%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,971,924	N419S	possibly damaging	Het
Akt2	T	C	7: 27,616,349	L52P	possibly damaging	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Chic2	T	C	5: 75,044,282	E6G	probably benign	Het
Clca4a	T	A	3: 144,957,298	T597S	probably benign	Het
Col5a2	C	A	1: 45,378,327	D1363Y	probably damaging	Het
Csmd1	C	T	8: 16,211,695		probably null	Het
Dnah7b	A	T	1: 46,099,431	Y211F	probably damaging	Het
Efcab3	A	T	11: 105,100,019	Y5460F	possibly damaging	Het
Efcab6	T	A	15: 84,044,322		probably null	Het
Eno4	T	A	19: 58,962,794	Y237N	probably damaging	Het
Fer1l4	T	A	2: 156,045,470	D602V	probably benign	Het
Fgfr2	T	C	7: 130,198,550	N337S	probably damaging	Het
Fras1	C	T	5: 96,759,564	R3203C	possibly damaging	Het
Gbp2	T	A	3: 142,632,008	V295E	probably damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Hyal4	A	G	6: 24,765,746	I366M	possibly damaging	Het
Itsn2	C	T	12: 4,634,792	R448*	probably null	Het
Klhl35	G	T	7: 99,472,899	W69L	probably damaging	Het
Kpnb1	T	C	11: 97,181,648	I154V	probably benign	Het
Lax1	T	A	1: 133,680,448	Y185F	probably damaging	Het
Mmp12	C	T	9: 7,353,479	P208L	probably damaging	Het
Ndufb8	C	T	19: 44,555,305	V33M	probably null	Het
Nptn	T	G	9: 58,623,752	C169G	probably damaging	Het
Nuggc	A	T	14: 65,648,222	E766V	probably damaging	Het
Olfr1117-ps1	A	T	2: 87,309,176	N149I	possibly damaging	Het
Olfr1150-ps1	A	T	2: 87,357,632	K63*	probably null	Het
Pcdhga6	T	A	18: 37,708,541	I438N	probably damaging	Het
Pkn2	T	C	3: 142,803,668	N721S	possibly damaging	Het
Pole	T	C	5: 110,324,722	W1590R	possibly damaging	Het
Prph2	A	G	17: 46,911,081	T129A	probably benign	Het
Rbck1	T	C	2: 152,330,966	D54G	possibly damaging	Het
Serpinb7	T	A	1: 107,435,346	L80*	probably null	Het
Setdb2	T	A	14: 59,402,414	Y676F	probably benign	Het
Skint1	G	T	4: 112,010,712	C12F	probably benign	Het
Slc22a26	T	A	19: 7,802,286	D55V	probably damaging	Het
Slc9a8	G	A	2: 167,424,291	V63I	probably damaging	Het
Sox2	T	A	3: 34,651,097	S228T	probably benign	Het
Spg11	A	G	2: 122,113,225	S149P	probably damaging	Het
Tbc1d19	T	A	5: 53,829,383	S45T	probably benign	Het
Tsacc	T	C	3: 88,295,396	E11G	probably benign	Het
Ttc7b	C	T	12: 100,495,407	A104T	possibly damaging	Het
Uox	C	T	3: 146,624,577	R163*	probably null	Het
Zfp108	T	A	7: 24,261,357	F458I	probably damaging	Het
Zfp616	A	T	11: 74,085,192	K762N	probably damaging	Het

Other mutations in Ptpro

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Ptpro	APN	6	137394909	critical splice donor site	probably null
IGL00844:Ptpro	APN	6	137414239	missense	probably damaging	1.00
IGL00983:Ptpro	APN	6	137418248	missense	probably benign	0.01
IGL01073:Ptpro	APN	6	137377088	missense	probably damaging	1.00
IGL01832:Ptpro	APN	6	137393668	missense	possibly damaging	0.93
IGL02308:Ptpro	APN	6	137454700	missense	probably benign	0.37
IGL02387:Ptpro	APN	6	137410980	missense	probably damaging	0.96
IGL02605:Ptpro	APN	6	137380318	missense	probably benign	0.02
IGL02666:Ptpro	APN	6	137378059	missense	probably damaging	0.96
IGL03275:Ptpro	APN	6	137450006	missense	probably damaging	1.00
Brau	UTSW	6	137454598	missense	probably damaging	1.00
court	UTSW	6	137393675	nonsense	probably null
Hoff	UTSW	6	137443594	missense	probably damaging	1.00
Jester	UTSW	6	137449917	missense	probably damaging	1.00
mann	UTSW	6	137411116	splice site	probably null
R0017:Ptpro	UTSW	6	137416827	missense	probably benign	0.03
R0017:Ptpro	UTSW	6	137416827	missense	probably benign	0.03
R0020:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0022:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0023:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0024:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0094:Ptpro	UTSW	6	137386352	missense	probably benign	0.08
R0094:Ptpro	UTSW	6	137386352	missense	probably benign	0.08
R0103:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0106:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0316:Ptpro	UTSW	6	137376989	missense	possibly damaging	0.81
R0427:Ptpro	UTSW	6	137368296	missense	possibly damaging	0.81
R0456:Ptpro	UTSW	6	137414230	missense	probably benign	0.04
R0536:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0537:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0552:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0555:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0664:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0708:Ptpro	UTSW	6	137386253	missense	probably benign	0.26
R0730:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0735:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0738:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0786:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0811:Ptpro	UTSW	6	137368079	missense	probably benign	0.00
R0812:Ptpro	UTSW	6	137368079	missense	probably benign	0.00
R0881:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R0973:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1145:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1145:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1146:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1146:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1147:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1147:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1259:Ptpro	UTSW	6	137392741	missense	probably damaging	0.98
R1340:Ptpro	UTSW	6	137441081	missense	possibly damaging	0.95
R1381:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1382:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1385:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1396:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1401:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1416:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1422:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1448:Ptpro	UTSW	6	137441116	missense	probably damaging	1.00
R1513:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1518:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1526:Ptpro	UTSW	6	137461726	missense	probably damaging	1.00
R1540:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1571:Ptpro	UTSW	6	137378130	missense	probably benign
R1573:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1587:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1588:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1649:Ptpro	UTSW	6	137444017	nonsense	probably null
R1700:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1701:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1745:Ptpro	UTSW	6	137400645	missense	probably benign	0.03
R1772:Ptpro	UTSW	6	137430743	missense	probably damaging	1.00
R1911:Ptpro	UTSW	6	137400619	splice site	probably benign
R1958:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R1967:Ptpro	UTSW	6	137416865	missense	probably benign	0.38
R2025:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R2026:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R2040:Ptpro	UTSW	6	137386164	splice site	probably benign
R2115:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R2117:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R2130:Ptpro	UTSW	6	137411116	splice site	probably null
R2161:Ptpro	UTSW	6	137449887	missense	probably benign	0.01
R2431:Ptpro	UTSW	6	137443585	nonsense	probably null
R2915:Ptpro	UTSW	6	137414241	start gained	probably benign
R2988:Ptpro	UTSW	6	137443599	nonsense	probably null
R3772:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3773:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3795:Ptpro	UTSW	6	137380309	missense	probably benign
R3885:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3886:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3887:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3888:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R3893:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R4032:Ptpro	UTSW	6	137461742	missense	probably damaging	1.00
R4133:Ptpro	UTSW	6	137420372	missense	probably damaging	1.00
R4377:Ptpro	UTSW	6	137380266	missense	probably benign	0.26
R4455:Ptpro	UTSW	6	137393659	missense	probably damaging	1.00
R4613:Ptpro	UTSW	6	137416836	nonsense	probably null
R4827:Ptpro	UTSW	6	137442710	missense	probably damaging	1.00
R4863:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R4870:Ptpro	UTSW	6	137377132	missense	probably damaging	0.96
R4910:Ptpro	UTSW	6	137368338	missense	probably damaging	0.99
R4932:Ptpro	UTSW	6	137411105	nonsense	probably null
R4941:Ptpro	UTSW	6	137392765	missense	probably damaging	1.00
R4989:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R5009:Ptpro	UTSW	6	137377132	missense	probably damaging	0.96
R5032:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R5033:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R5162:Ptpro	UTSW	6	137443594	missense	probably damaging	1.00
R5393:Ptpro	UTSW	6	137380224	missense	probably benign	0.04
R5423:Ptpro	UTSW	6	137442707	missense	probably damaging	1.00
R5782:Ptpro	UTSW	6	137399498	missense	possibly damaging	0.80
R6103:Ptpro	UTSW	6	137400706	missense	possibly damaging	0.76
R6239:Ptpro	UTSW	6	137380608	missense	probably benign	0.28
R6488:Ptpro	UTSW	6	137393675	nonsense	probably null
R6746:Ptpro	UTSW	6	137394823	missense	probably damaging	1.00
R6763:Ptpro	UTSW	6	137418281	splice site	probably null
R6888:Ptpro	UTSW	6	137380200	missense	probably benign	0.30
R6983:Ptpro	UTSW	6	137449917	missense	probably damaging	1.00
R7019:Ptpro	UTSW	6	137380478	missense	probably benign
R7218:Ptpro	UTSW	6	137454598	missense	probably damaging	1.00
R7236:Ptpro	UTSW	6	137368337	missense	probably damaging	1.00
R7299:Ptpro	UTSW	6	137441144	critical splice donor site	probably null
R7381:Ptpro	UTSW	6	137399561	missense	possibly damaging	0.93
R7493:Ptpro	UTSW	6	137382649	missense	probably benign	0.01
R7733:Ptpro	UTSW	6	137414286	nonsense	probably null
R7793:Ptpro	UTSW	6	137416820	missense	probably damaging	0.99
R7804:Ptpro	UTSW	6	137399601	splice site	probably null
R7833:Ptpro	UTSW	6	137416863	nonsense	probably null
R7859:Ptpro	UTSW	6	137392807	critical splice donor site	probably null
R7873:Ptpro	UTSW	6	137430739	missense	probably benign	0.44
R8042:Ptpro	UTSW	6	137416883	missense	possibly damaging	0.71
R8859:Ptpro	UTSW	6	137426784	nonsense	probably null
R8979:Ptpro	UTSW	6	137368142	missense	probably benign
R9138:Ptpro	UTSW	6	137411115	critical splice donor site	probably null
R9309:Ptpro	UTSW	6	137454658	missense	probably damaging	1.00
R9420:Ptpro	UTSW	6	137443935	missense	probably benign	0.08
R9612:Ptpro	UTSW	6	137414320	missense	probably benign	0.31
R9625:Ptpro	UTSW	6	137394875	missense	probably damaging	1.00
R9697:Ptpro	UTSW	6	137386290	missense	probably damaging	1.00
R9715:Ptpro	UTSW	6	137368110	missense	probably damaging	0.96
Z1177:Ptpro	UTSW	6	137378140	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGCCGTAAAGGTTAAGGTTGAAC -3'
(R):5'- CAGTTTCCTGTTGGAGCTCC -3'

Sequencing Primer
(F):5'- GGTTAAGGTTGAACTTGGAATGTAAG -3'
(R):5'- TTCCTGTTGGAGCTCCCGAAG -3'

Posted On

2018-06-06