Incidental Mutation 'R6494:Mmp12'
ID 522965
Institutional Source Beutler Lab
Gene Symbol Mmp12
Ensembl Gene ENSMUSG00000049723
Gene Name matrix metallopeptidase 12
Synonyms Mmel, macrophage elastase, MMP12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock # R6494 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 7344381-7369499 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 7353479 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 208 (P208L)
Ref Sequence ENSEMBL: ENSMUSP00000114129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005950] [ENSMUST00000065079] [ENSMUST00000120655] [ENSMUST00000127722] [ENSMUST00000150167]
AlphaFold P34960
Predicted Effect possibly damaging
Transcript: ENSMUST00000005950
AA Change: P278L

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000005950
Gene: ENSMUSG00000049723
AA Change: P278L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:PG_binding_1 30 91 7.6e-22 PFAM
ZnMc 109 268 2.76e-57 SMART
low complexity region 269 284 N/A INTRINSIC
HX 292 334 1.44e-6 SMART
HX 336 379 2.03e-6 SMART
HX 384 431 2.29e-14 SMART
HX 433 473 2.94e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065079
SMART Domains Protein: ENSMUSP00000065291
Gene: ENSMUSG00000049723

DomainStartEndE-ValueType
Pfam:PG_binding_1 30 91 6.5e-22 PFAM
ZnMc 109 268 1.23e-54 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120655
AA Change: P208L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114129
Gene: ENSMUSG00000049723
AA Change: P208L

DomainStartEndE-ValueType
Pfam:PG_binding_1 1 21 9.1e-9 PFAM
ZnMc 39 198 2.76e-57 SMART
low complexity region 199 214 N/A INTRINSIC
HX 222 264 1.44e-6 SMART
HX 266 309 2.03e-6 SMART
HX 314 361 2.29e-14 SMART
HX 363 403 2.94e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127722
SMART Domains Protein: ENSMUSP00000120225
Gene: ENSMUSG00000049723

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148005
Predicted Effect probably benign
Transcript: ENSMUST00000150167
SMART Domains Protein: ENSMUSP00000116080
Gene: ENSMUSG00000049723

DomainStartEndE-ValueType
Pfam:PG_binding_1 1 21 7.3e-10 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein have a diminished capacity to degrade extracellular matrix components, do not develop emphysema in response to long-term exposure to cigarette smoke, and exhibit impaired clearance and increased mortality upon bacterial infection. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. Alternate splicing generates multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased sensitivity to cigarette smoke, decreased littler size, abnormal myelination, abnormal macrophage physiology, and decreased oligodedrocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,924 N419S possibly damaging Het
Akt2 T C 7: 27,616,349 L52P possibly damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chic2 T C 5: 75,044,282 E6G probably benign Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Col5a2 C A 1: 45,378,327 D1363Y probably damaging Het
Csmd1 C T 8: 16,211,695 probably null Het
Dnah7b A T 1: 46,099,431 Y211F probably damaging Het
Efcab3 A T 11: 105,100,019 Y5460F possibly damaging Het
Efcab6 T A 15: 84,044,322 probably null Het
Eno4 T A 19: 58,962,794 Y237N probably damaging Het
Fer1l4 T A 2: 156,045,470 D602V probably benign Het
Fgfr2 T C 7: 130,198,550 N337S probably damaging Het
Fras1 C T 5: 96,759,564 R3203C possibly damaging Het
Gbp2 T A 3: 142,632,008 V295E probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Hyal4 A G 6: 24,765,746 I366M possibly damaging Het
Itsn2 C T 12: 4,634,792 R448* probably null Het
Klhl35 G T 7: 99,472,899 W69L probably damaging Het
Kpnb1 T C 11: 97,181,648 I154V probably benign Het
Lax1 T A 1: 133,680,448 Y185F probably damaging Het
Ndufb8 C T 19: 44,555,305 V33M probably null Het
Nptn T G 9: 58,623,752 C169G probably damaging Het
Nuggc A T 14: 65,648,222 E766V probably damaging Het
Olfr1117-ps1 A T 2: 87,309,176 N149I possibly damaging Het
Olfr1150-ps1 A T 2: 87,357,632 K63* probably null Het
Pcdhga6 T A 18: 37,708,541 I438N probably damaging Het
Pkn2 T C 3: 142,803,668 N721S possibly damaging Het
Pole T C 5: 110,324,722 W1590R possibly damaging Het
Prph2 A G 17: 46,911,081 T129A probably benign Het
Ptpro A T 6: 137,382,642 K403N probably benign Het
Rbck1 T C 2: 152,330,966 D54G possibly damaging Het
Serpinb7 T A 1: 107,435,346 L80* probably null Het
Setdb2 T A 14: 59,402,414 Y676F probably benign Het
Skint1 G T 4: 112,010,712 C12F probably benign Het
Slc22a26 T A 19: 7,802,286 D55V probably damaging Het
Slc9a8 G A 2: 167,424,291 V63I probably damaging Het
Sox2 T A 3: 34,651,097 S228T probably benign Het
Spg11 A G 2: 122,113,225 S149P probably damaging Het
Tbc1d19 T A 5: 53,829,383 S45T probably benign Het
Tsacc T C 3: 88,295,396 E11G probably benign Het
Ttc7b C T 12: 100,495,407 A104T possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp108 T A 7: 24,261,357 F458I probably damaging Het
Zfp616 A T 11: 74,085,192 K762N probably damaging Het
Other mutations in Mmp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Mmp12 APN 9 7358307 missense possibly damaging 0.57
IGL03047:Mmp12 APN 9 7357797 splice site probably benign
IGL03224:Mmp12 APN 9 7350002 unclassified probably benign
IGL03247:Mmp12 APN 9 7348631 missense probably benign 0.05
R0050:Mmp12 UTSW 9 7350152 unclassified probably benign
R0480:Mmp12 UTSW 9 7350016 missense probably damaging 1.00
R0729:Mmp12 UTSW 9 7358290 missense possibly damaging 0.82
R0800:Mmp12 UTSW 9 7357827 missense possibly damaging 0.74
R1114:Mmp12 UTSW 9 7358289 missense possibly damaging 0.69
R1441:Mmp12 UTSW 9 7354787 missense probably damaging 0.98
R1765:Mmp12 UTSW 9 7354772 missense probably damaging 1.00
R2071:Mmp12 UTSW 9 7349725 missense probably damaging 1.00
R2102:Mmp12 UTSW 9 7349802 missense probably damaging 1.00
R2882:Mmp12 UTSW 9 7358236 missense probably damaging 1.00
R2936:Mmp12 UTSW 9 7357819 missense probably benign
R4645:Mmp12 UTSW 9 7347515 missense probably benign 0.04
R5210:Mmp12 UTSW 9 7349729 nonsense probably null
R5499:Mmp12 UTSW 9 7353000 missense probably benign 0.02
R5774:Mmp12 UTSW 9 7354823 missense possibly damaging 0.84
R5778:Mmp12 UTSW 9 7350106 missense probably damaging 1.00
R5841:Mmp12 UTSW 9 7347501 missense possibly damaging 0.93
R5869:Mmp12 UTSW 9 7348446 intron probably benign
R6044:Mmp12 UTSW 9 7350050 missense possibly damaging 0.94
R6651:Mmp12 UTSW 9 7355345 missense possibly damaging 0.62
R7057:Mmp12 UTSW 9 7357840 missense probably damaging 1.00
R7057:Mmp12 UTSW 9 7369173 missense probably benign 0.33
R8938:Mmp12 UTSW 9 7348446 intron probably benign
R9024:Mmp12 UTSW 9 7355444 missense probably damaging 1.00
R9630:Mmp12 UTSW 9 7347516 missense probably benign 0.02
X0062:Mmp12 UTSW 9 7353013 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGAGTATGATAATGTCCTCCAGG -3'
(R):5'- AGAATCAAGTTGAAGTTCCTGCC -3'

Sequencing Primer
(F):5'- GGAACGCTTCTCCTGAATTTCATAGG -3'
(R):5'- CAAGTTGAAGTTCCTGCCATATGG -3'
Posted On 2018-06-06