Incidental Mutation 'R6494:Nptn'
ID 522967
Institutional Source Beutler Lab
Gene Symbol Nptn
Ensembl Gene ENSMUSG00000032336
Gene Name neuroplastin
Synonyms Sdfr1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6494 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 58582240-58657955 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 58623752 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Glycine at position 169 (C169G)
Ref Sequence ENSEMBL: ENSMUSP00000135199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085651] [ENSMUST00000114121] [ENSMUST00000175945] [ENSMUST00000176557] [ENSMUST00000177064] [ENSMUST00000177292] [ENSMUST00000177380]
AlphaFold P97300
Predicted Effect probably damaging
Transcript: ENSMUST00000085651
AA Change: C53G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082793
Gene: ENSMUSG00000032336
AA Change: C53G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 38 118 1.1e-3 SMART
IGc2 133 206 9.3e-7 SMART
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114121
AA Change: C53G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109756
Gene: ENSMUSG00000032336
AA Change: C53G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 38 118 2.56e-1 SMART
IGc2 133 206 2.34e-4 SMART
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175945
SMART Domains Protein: ENSMUSP00000135576
Gene: ENSMUSG00000032336

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176126
Predicted Effect probably damaging
Transcript: ENSMUST00000176557
AA Change: C53G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135541
Gene: ENSMUSG00000032336
AA Change: C53G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 38 118 2.56e-1 SMART
IGc2 133 206 2.34e-4 SMART
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000176896
AA Change: C51G
SMART Domains Protein: ENSMUSP00000134761
Gene: ENSMUSG00000032336
AA Change: C51G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IG 37 117 2.56e-1 SMART
IGc2 132 205 2.34e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177064
SMART Domains Protein: ENSMUSP00000135316
Gene: ENSMUSG00000032336

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 45 118 2.34e-4 SMART
transmembrane domain 133 155 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177292
AA Change: C169G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135199
Gene: ENSMUSG00000032336
AA Change: C169G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 43 123 4.09e-9 SMART
IG 154 234 2.56e-1 SMART
IGc2 249 322 2.34e-4 SMART
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177380
AA Change: C53G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135886
Gene: ENSMUSG00000032336
AA Change: C53G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 38 118 2.56e-1 SMART
Meta Mutation Damage Score 0.9610 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal dendritic spine morphology, decreased CNS synapse formation, abnormal CNS synaptic transmission and impaired hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,924 N419S possibly damaging Het
Akt2 T C 7: 27,616,349 L52P possibly damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chic2 T C 5: 75,044,282 E6G probably benign Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Col5a2 C A 1: 45,378,327 D1363Y probably damaging Het
Csmd1 C T 8: 16,211,695 probably null Het
Dnah7b A T 1: 46,099,431 Y211F probably damaging Het
Efcab3 A T 11: 105,100,019 Y5460F possibly damaging Het
Efcab6 T A 15: 84,044,322 probably null Het
Eno4 T A 19: 58,962,794 Y237N probably damaging Het
Fer1l4 T A 2: 156,045,470 D602V probably benign Het
Fgfr2 T C 7: 130,198,550 N337S probably damaging Het
Fras1 C T 5: 96,759,564 R3203C possibly damaging Het
Gbp2 T A 3: 142,632,008 V295E probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Hyal4 A G 6: 24,765,746 I366M possibly damaging Het
Itsn2 C T 12: 4,634,792 R448* probably null Het
Klhl35 G T 7: 99,472,899 W69L probably damaging Het
Kpnb1 T C 11: 97,181,648 I154V probably benign Het
Lax1 T A 1: 133,680,448 Y185F probably damaging Het
Mmp12 C T 9: 7,353,479 P208L probably damaging Het
Ndufb8 C T 19: 44,555,305 V33M probably null Het
Nuggc A T 14: 65,648,222 E766V probably damaging Het
Olfr1117-ps1 A T 2: 87,309,176 N149I possibly damaging Het
Olfr1150-ps1 A T 2: 87,357,632 K63* probably null Het
Pcdhga6 T A 18: 37,708,541 I438N probably damaging Het
Pkn2 T C 3: 142,803,668 N721S possibly damaging Het
Pole T C 5: 110,324,722 W1590R possibly damaging Het
Prph2 A G 17: 46,911,081 T129A probably benign Het
Ptpro A T 6: 137,382,642 K403N probably benign Het
Rbck1 T C 2: 152,330,966 D54G possibly damaging Het
Serpinb7 T A 1: 107,435,346 L80* probably null Het
Setdb2 T A 14: 59,402,414 Y676F probably benign Het
Skint1 G T 4: 112,010,712 C12F probably benign Het
Slc22a26 T A 19: 7,802,286 D55V probably damaging Het
Slc9a8 G A 2: 167,424,291 V63I probably damaging Het
Sox2 T A 3: 34,651,097 S228T probably benign Het
Spg11 A G 2: 122,113,225 S149P probably damaging Het
Tbc1d19 T A 5: 53,829,383 S45T probably benign Het
Tsacc T C 3: 88,295,396 E11G probably benign Het
Ttc7b C T 12: 100,495,407 A104T possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp108 T A 7: 24,261,357 F458I probably damaging Het
Zfp616 A T 11: 74,085,192 K762N probably damaging Het
Other mutations in Nptn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Nptn APN 9 58643639 missense probably damaging 1.00
IGL02043:Nptn APN 9 58640729 missense possibly damaging 0.56
kinda_slow UTSW 9 58623752 missense probably damaging 1.00
R0212:Nptn UTSW 9 58627881 missense probably benign 0.03
R1585:Nptn UTSW 9 58640790 missense probably benign 0.17
R1673:Nptn UTSW 9 58623732 missense probably benign 0.12
R2484:Nptn UTSW 9 58643673 missense possibly damaging 0.85
R4151:Nptn UTSW 9 58643542 missense probably benign 0.14
R4389:Nptn UTSW 9 58643772 missense probably damaging 1.00
R4721:Nptn UTSW 9 58640776 missense probably damaging 1.00
R5166:Nptn UTSW 9 58618980 nonsense probably null
R5346:Nptn UTSW 9 58623787 nonsense probably null
R6520:Nptn UTSW 9 58643734 missense probably damaging 1.00
R7506:Nptn UTSW 9 58618873 missense probably damaging 1.00
R8762:Nptn UTSW 9 58618622 intron probably benign
R8867:Nptn UTSW 9 58618981 missense probably damaging 1.00
R9124:Nptn UTSW 9 58651215 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CAGTGTAGTCCTGTCTGCC -3'
(R):5'- TTTAGTATATGCACCACACATGC -3'

Sequencing Primer
(F):5'- GTGTAGTCCTGTCTGCCTTCCC -3'
(R):5'- AAGCACCGTTACCTGCTGAG -3'
Posted On 2018-06-06