Incidental Mutation 'R6494:Zfp616'
ID 522969
Institutional Source Beutler Lab
Gene Symbol Zfp616
Ensembl Gene ENSMUSG00000069476
Gene Name zinc finger protein 616
Synonyms Gm12330
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6494 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 74069955-74087292 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 74085192 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 762 (K762N)
Ref Sequence ENSEMBL: ENSMUSP00000136549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074813] [ENSMUST00000108463] [ENSMUST00000116546] [ENSMUST00000178159]
AlphaFold J3QN14
Predicted Effect probably benign
Transcript: ENSMUST00000074813
SMART Domains Protein: ENSMUSP00000074365
Gene: ENSMUSG00000069476

DomainStartEndE-ValueType
KRAB 8 68 1.79e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108463
SMART Domains Protein: ENSMUSP00000104103
Gene: ENSMUSG00000069476

DomainStartEndE-ValueType
KRAB 8 68 1.79e-34 SMART
low complexity region 249 258 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116546
SMART Domains Protein: ENSMUSP00000112245
Gene: ENSMUSG00000069476

DomainStartEndE-ValueType
KRAB 8 68 1.79e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137407
Predicted Effect probably damaging
Transcript: ENSMUST00000178159
AA Change: K762N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136549
Gene: ENSMUSG00000069476
AA Change: K762N

DomainStartEndE-ValueType
internal_repeat_1 125 447 7.61e-6 PROSPERO
ZnF_C2H2 452 474 3.11e-2 SMART
ZnF_C2H2 509 531 2.61e-4 SMART
ZnF_C2H2 537 559 1.47e-3 SMART
ZnF_C2H2 565 587 5.21e-4 SMART
ZnF_C2H2 593 615 1.22e-4 SMART
ZnF_C2H2 621 643 2.57e-3 SMART
ZnF_C2H2 649 671 9.22e-5 SMART
ZnF_C2H2 677 699 5.9e-3 SMART
ZnF_C2H2 705 727 4.94e-5 SMART
ZnF_C2H2 733 755 8.34e-3 SMART
ZnF_C2H2 761 783 1.6e-4 SMART
ZnF_C2H2 789 811 6.88e-4 SMART
ZnF_C2H2 817 839 1.6e-4 SMART
ZnF_C2H2 845 867 1.3e-4 SMART
ZnF_C2H2 873 895 7.37e-4 SMART
ZnF_C2H2 901 923 1.6e-4 SMART
ZnF_C2H2 929 951 1.3e-4 SMART
ZnF_C2H2 957 979 3.95e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,924 N419S possibly damaging Het
Akt2 T C 7: 27,616,349 L52P possibly damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chic2 T C 5: 75,044,282 E6G probably benign Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Col5a2 C A 1: 45,378,327 D1363Y probably damaging Het
Csmd1 C T 8: 16,211,695 probably null Het
Dnah7b A T 1: 46,099,431 Y211F probably damaging Het
Efcab3 A T 11: 105,100,019 Y5460F possibly damaging Het
Efcab6 T A 15: 84,044,322 probably null Het
Eno4 T A 19: 58,962,794 Y237N probably damaging Het
Fer1l4 T A 2: 156,045,470 D602V probably benign Het
Fgfr2 T C 7: 130,198,550 N337S probably damaging Het
Fras1 C T 5: 96,759,564 R3203C possibly damaging Het
Gbp2 T A 3: 142,632,008 V295E probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Hyal4 A G 6: 24,765,746 I366M possibly damaging Het
Itsn2 C T 12: 4,634,792 R448* probably null Het
Klhl35 G T 7: 99,472,899 W69L probably damaging Het
Kpnb1 T C 11: 97,181,648 I154V probably benign Het
Lax1 T A 1: 133,680,448 Y185F probably damaging Het
Mmp12 C T 9: 7,353,479 P208L probably damaging Het
Ndufb8 C T 19: 44,555,305 V33M probably null Het
Nptn T G 9: 58,623,752 C169G probably damaging Het
Nuggc A T 14: 65,648,222 E766V probably damaging Het
Olfr1117-ps1 A T 2: 87,309,176 N149I possibly damaging Het
Olfr1150-ps1 A T 2: 87,357,632 K63* probably null Het
Pcdhga6 T A 18: 37,708,541 I438N probably damaging Het
Pkn2 T C 3: 142,803,668 N721S possibly damaging Het
Pole T C 5: 110,324,722 W1590R possibly damaging Het
Prph2 A G 17: 46,911,081 T129A probably benign Het
Ptpro A T 6: 137,382,642 K403N probably benign Het
Rbck1 T C 2: 152,330,966 D54G possibly damaging Het
Serpinb7 T A 1: 107,435,346 L80* probably null Het
Setdb2 T A 14: 59,402,414 Y676F probably benign Het
Skint1 G T 4: 112,010,712 C12F probably benign Het
Slc22a26 T A 19: 7,802,286 D55V probably damaging Het
Slc9a8 G A 2: 167,424,291 V63I probably damaging Het
Sox2 T A 3: 34,651,097 S228T probably benign Het
Spg11 A G 2: 122,113,225 S149P probably damaging Het
Tbc1d19 T A 5: 53,829,383 S45T probably benign Het
Tsacc T C 3: 88,295,396 E11G probably benign Het
Ttc7b C T 12: 100,495,407 A104T possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp108 T A 7: 24,261,357 F458I probably damaging Het
Other mutations in Zfp616
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Zfp616 APN 11 74083613 missense probably damaging 0.98
IGL00570:Zfp616 APN 11 74085805 missense probably benign 0.03
IGL00594:Zfp616 APN 11 74082963 missense possibly damaging 0.72
IGL01861:Zfp616 APN 11 74082916 missense possibly damaging 0.53
IGL03022:Zfp616 APN 11 74082974 missense possibly damaging 0.85
R0197:Zfp616 UTSW 11 74085674 missense probably damaging 1.00
R0442:Zfp616 UTSW 11 74084495 missense possibly damaging 0.92
R0497:Zfp616 UTSW 11 74083480 missense probably benign 0.00
R0651:Zfp616 UTSW 11 74083729 nonsense probably null
R0730:Zfp616 UTSW 11 74084822 missense probably damaging 1.00
R0883:Zfp616 UTSW 11 74085674 missense probably damaging 1.00
R0926:Zfp616 UTSW 11 74085818 missense probably benign 0.04
R0940:Zfp616 UTSW 11 74085024 missense probably damaging 1.00
R1068:Zfp616 UTSW 11 74082941 makesense probably null
R1272:Zfp616 UTSW 11 74085236 missense probably benign 0.08
R1446:Zfp616 UTSW 11 74083238 splice site probably null
R1482:Zfp616 UTSW 11 74083977 missense possibly damaging 0.72
R1553:Zfp616 UTSW 11 74083918 missense possibly damaging 0.53
R1564:Zfp616 UTSW 11 74084722 missense probably damaging 1.00
R1728:Zfp616 UTSW 11 74085771 missense probably damaging 0.99
R1796:Zfp616 UTSW 11 74085845 missense probably damaging 0.98
R1797:Zfp616 UTSW 11 74085279 nonsense probably null
R1993:Zfp616 UTSW 11 74084969 missense probably benign 0.08
R2026:Zfp616 UTSW 11 74083587 missense possibly damaging 0.86
R2124:Zfp616 UTSW 11 74083043 splice site probably null
R2126:Zfp616 UTSW 11 74085403 missense probably benign 0.08
R2199:Zfp616 UTSW 11 74084630 missense possibly damaging 0.58
R2265:Zfp616 UTSW 11 74085463 missense possibly damaging 0.89
R2404:Zfp616 UTSW 11 74084856 missense probably damaging 1.00
R2508:Zfp616 UTSW 11 74083295 missense probably benign 0.01
R2519:Zfp616 UTSW 11 74084268 nonsense probably null
R3103:Zfp616 UTSW 11 74071735 missense probably benign 0.01
R3611:Zfp616 UTSW 11 74083442 missense possibly damaging 0.53
R3703:Zfp616 UTSW 11 74083319 nonsense probably null
R3744:Zfp616 UTSW 11 74083987 missense probably benign 0.01
R4043:Zfp616 UTSW 11 74085282 missense possibly damaging 0.50
R4273:Zfp616 UTSW 11 74083700 missense probably benign 0.00
R4384:Zfp616 UTSW 11 74083179 missense possibly damaging 0.94
R4469:Zfp616 UTSW 11 74071124 missense probably damaging 0.98
R4560:Zfp616 UTSW 11 74083034 missense probably benign 0.00
R4821:Zfp616 UTSW 11 74084207 missense probably benign 0.41
R4844:Zfp616 UTSW 11 74084399 missense probably benign 0.10
R4948:Zfp616 UTSW 11 74084004 missense possibly damaging 0.72
R5007:Zfp616 UTSW 11 74083817 missense possibly damaging 0.96
R5198:Zfp616 UTSW 11 74083510 missense probably benign 0.33
R5344:Zfp616 UTSW 11 74084495 missense possibly damaging 0.92
R5918:Zfp616 UTSW 11 74083260 missense possibly damaging 0.70
R5933:Zfp616 UTSW 11 74083126 missense probably damaging 0.96
R6084:Zfp616 UTSW 11 74083846 nonsense probably null
R6421:Zfp616 UTSW 11 74083870 missense possibly damaging 0.53
R6523:Zfp616 UTSW 11 74083142 missense possibly damaging 0.79
R6849:Zfp616 UTSW 11 74085450 missense possibly damaging 0.70
R6910:Zfp616 UTSW 11 74085002 missense probably damaging 1.00
R7146:Zfp616 UTSW 11 74085261 missense possibly damaging 0.61
R7213:Zfp616 UTSW 11 74085863 missense probably benign 0.05
R7302:Zfp616 UTSW 11 74085379 missense probably benign 0.08
R7391:Zfp616 UTSW 11 74085329 missense probably benign 0.08
R7654:Zfp616 UTSW 11 74083187 missense possibly damaging 0.53
R7877:Zfp616 UTSW 11 74084362 missense probably damaging 1.00
R7889:Zfp616 UTSW 11 74085445 missense probably damaging 1.00
R8022:Zfp616 UTSW 11 74084068 missense probably benign
R8061:Zfp616 UTSW 11 74083514 missense possibly damaging 0.96
R8212:Zfp616 UTSW 11 74085743 missense probably damaging 0.96
R8335:Zfp616 UTSW 11 74083900 nonsense probably null
R8361:Zfp616 UTSW 11 74084650 missense probably damaging 0.98
R8486:Zfp616 UTSW 11 74084083 missense probably benign 0.18
R8695:Zfp616 UTSW 11 74084884 missense probably benign 0.45
R8808:Zfp616 UTSW 11 74085697 missense probably damaging 1.00
R9022:Zfp616 UTSW 11 74085713 missense probably damaging 1.00
R9126:Zfp616 UTSW 11 74085454 missense probably damaging 1.00
R9164:Zfp616 UTSW 11 74084999 missense probably damaging 1.00
R9293:Zfp616 UTSW 11 74083918 missense possibly damaging 0.53
R9421:Zfp616 UTSW 11 74083505 missense possibly damaging 0.72
R9512:Zfp616 UTSW 11 74085110 missense probably damaging 1.00
R9529:Zfp616 UTSW 11 74084834 missense probably damaging 1.00
R9529:Zfp616 UTSW 11 74085770 missense possibly damaging 0.90
R9606:Zfp616 UTSW 11 74085394 missense probably damaging 1.00
R9708:Zfp616 UTSW 11 74085457 missense probably damaging 1.00
R9788:Zfp616 UTSW 11 74084450 missense probably damaging 0.99
Z1176:Zfp616 UTSW 11 74083033 missense probably benign
Z1176:Zfp616 UTSW 11 74083219 missense possibly damaging 0.72
Z1176:Zfp616 UTSW 11 74085641 missense possibly damaging 0.90
Z1177:Zfp616 UTSW 11 74085052 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CATTCCTCAAGTCTTAAAGGTCAC -3'
(R):5'- ACTTGAGGAACGGGCAAAATATTT -3'

Sequencing Primer
(F):5'- TCAAGTCTTAAAGGTCACCACAG -3'
(R):5'- CTTGAAGATTTGAAGACTGGGC -3'
Posted On 2018-06-06