Mutagenetix > Incidental Mutation

Incidental Mutation 'R6494:Itsn2'

522975

Institutional Source

Beutler Lab

Gene Symbol

Itsn2

Ensembl Gene

ENSMUSG00000020640

Gene Name

intersectin 2

Synonyms

Sh3d1B, Eh domain, SH3 domain regulator of endocytosis 2, Ese2, Sh3p18

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6494 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4592638-4713962 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 4634792 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 448 (R448*)

Ref Sequence

ENSEMBL: ENSMUSP00000151896 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062580] [ENSMUST00000219007] [ENSMUST00000220311]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000062580
AA Change: R448*

SMART Domains

Protein: ENSMUSP00000052758
Gene: ENSMUSG00000020640
AA Change: R448*

Domain	Start	End	E-Value	Type
EH	15	109	8.44e-41	SMART
EFh	58	86	7.18e-3	SMART
low complexity region	156	169	N/A	INTRINSIC
low complexity region	215	231	N/A	INTRINSIC
EH	238	333	4.06e-43	SMART
EFh	282	310	6.16e-2	SMART
coiled coil region	366	462	N/A	INTRINSIC
coiled coil region	516	556	N/A	INTRINSIC
coiled coil region	580	715	N/A	INTRINSIC
SH3	721	778	2.65e-21	SMART
low complexity region	791	811	N/A	INTRINSIC
SH3	855	909	8.83e-18	SMART
SH3	945	999	9.1e-20	SMART
SH3	1017	1077	1.55e-13	SMART
SH3	1091	1146	7.22e-23	SMART
RhoGEF	1174	1355	1.93e-56	SMART
PH	1396	1507	1.16e-9	SMART
C2	1531	1628	3.96e-19	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000217672
AA Change: R6*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217882

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217981

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218072

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218352

Predicted Effect

probably null
Transcript: ENSMUST00000219007
AA Change: R448*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219832

Predicted Effect

probably null
Transcript: ENSMUST00000220311
AA Change: R448*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 97.8%
20x: 92.4%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains SH3 domains. This protein is a member of a family of proteins involved in clathrin-mediated endocytosis. Intersectin 2 is thought to regulate the formation of clathrin-coated vesicles and also may function in the induction of T cell antigen receptor (TCR) endocytosis. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal brain morphology and function and behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,971,924	N419S	possibly damaging	Het
Akt2	T	C	7: 27,616,349	L52P	possibly damaging	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Chic2	T	C	5: 75,044,282	E6G	probably benign	Het
Clca4a	T	A	3: 144,957,298	T597S	probably benign	Het
Col5a2	C	A	1: 45,378,327	D1363Y	probably damaging	Het
Csmd1	C	T	8: 16,211,695		probably null	Het
Dnah7b	A	T	1: 46,099,431	Y211F	probably damaging	Het
Efcab3	A	T	11: 105,100,019	Y5460F	possibly damaging	Het
Efcab6	T	A	15: 84,044,322		probably null	Het
Eno4	T	A	19: 58,962,794	Y237N	probably damaging	Het
Fer1l4	T	A	2: 156,045,470	D602V	probably benign	Het
Fgfr2	T	C	7: 130,198,550	N337S	probably damaging	Het
Fras1	C	T	5: 96,759,564	R3203C	possibly damaging	Het
Gbp2	T	A	3: 142,632,008	V295E	probably damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Hyal4	A	G	6: 24,765,746	I366M	possibly damaging	Het
Klhl35	G	T	7: 99,472,899	W69L	probably damaging	Het
Kpnb1	T	C	11: 97,181,648	I154V	probably benign	Het
Lax1	T	A	1: 133,680,448	Y185F	probably damaging	Het
Mmp12	C	T	9: 7,353,479	P208L	probably damaging	Het
Ndufb8	C	T	19: 44,555,305	V33M	probably null	Het
Nptn	T	G	9: 58,623,752	C169G	probably damaging	Het
Nuggc	A	T	14: 65,648,222	E766V	probably damaging	Het
Olfr1117-ps1	A	T	2: 87,309,176	N149I	possibly damaging	Het
Olfr1150-ps1	A	T	2: 87,357,632	K63*	probably null	Het
Pcdhga6	T	A	18: 37,708,541	I438N	probably damaging	Het
Pkn2	T	C	3: 142,803,668	N721S	possibly damaging	Het
Pole	T	C	5: 110,324,722	W1590R	possibly damaging	Het
Prph2	A	G	17: 46,911,081	T129A	probably benign	Het
Ptpro	A	T	6: 137,382,642	K403N	probably benign	Het
Rbck1	T	C	2: 152,330,966	D54G	possibly damaging	Het
Serpinb7	T	A	1: 107,435,346	L80*	probably null	Het
Setdb2	T	A	14: 59,402,414	Y676F	probably benign	Het
Skint1	G	T	4: 112,010,712	C12F	probably benign	Het
Slc22a26	T	A	19: 7,802,286	D55V	probably damaging	Het
Slc9a8	G	A	2: 167,424,291	V63I	probably damaging	Het
Sox2	T	A	3: 34,651,097	S228T	probably benign	Het
Spg11	A	G	2: 122,113,225	S149P	probably damaging	Het
Tbc1d19	T	A	5: 53,829,383	S45T	probably benign	Het
Tsacc	T	C	3: 88,295,396	E11G	probably benign	Het
Ttc7b	C	T	12: 100,495,407	A104T	possibly damaging	Het
Uox	C	T	3: 146,624,577	R163*	probably null	Het
Zfp108	T	A	7: 24,261,357	F458I	probably damaging	Het
Zfp616	A	T	11: 74,085,192	K762N	probably damaging	Het

Other mutations in Itsn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Itsn2	APN	12	4658027	missense	possibly damaging	0.95
IGL00647:Itsn2	APN	12	4613311	splice site	probably benign
IGL00933:Itsn2	APN	12	4707540	missense	probably damaging	1.00
IGL01686:Itsn2	APN	12	4636693	splice site	probably benign
IGL01873:Itsn2	APN	12	4632366	splice site	probably benign
IGL02200:Itsn2	APN	12	4636632	missense	probably damaging	0.98
IGL02280:Itsn2	APN	12	4708961	missense	possibly damaging	0.89
IGL02388:Itsn2	APN	12	4629557	missense	possibly damaging	0.91
IGL02938:Itsn2	APN	12	4697216	missense	probably damaging	0.98
Gopher	UTSW	12	4706983	nonsense	probably null
inversus	UTSW	12	4639670	nonsense	probably null
Liberator	UTSW	12	4666176	nonsense	probably null
rolled	UTSW	12	4634792	nonsense	probably null
Stratofortress	UTSW	12	4624927	missense	probably damaging	1.00
Vole	UTSW	12	4673420	nonsense	probably null
R0101:Itsn2	UTSW	12	4633058	unclassified	probably benign
R0268:Itsn2	UTSW	12	4700333	missense	probably benign	0.12
R0584:Itsn2	UTSW	12	4697180	missense	probably benign
R0604:Itsn2	UTSW	12	4658189	missense	probably benign	0.01
R0639:Itsn2	UTSW	12	4712556	missense	probably damaging	0.99
R0738:Itsn2	UTSW	12	4635681	missense	probably benign	0.17
R1132:Itsn2	UTSW	12	4658464	missense	probably damaging	1.00
R1163:Itsn2	UTSW	12	4712009	missense	probably benign	0.30
R1169:Itsn2	UTSW	12	4639694	missense	probably damaging	1.00
R1258:Itsn2	UTSW	12	4673464	missense	probably damaging	1.00
R1297:Itsn2	UTSW	12	4700378	missense	probably damaging	1.00
R1423:Itsn2	UTSW	12	4673572	missense	probably damaging	0.97
R1572:Itsn2	UTSW	12	4650044	missense	probably benign	0.03
R1601:Itsn2	UTSW	12	4658452	missense	probably benign	0.01
R1628:Itsn2	UTSW	12	4629652	missense	probably benign
R1650:Itsn2	UTSW	12	4637767	missense	probably damaging	0.97
R1752:Itsn2	UTSW	12	4711950	splice site	probably null
R1758:Itsn2	UTSW	12	4658160	missense	possibly damaging	0.83
R1942:Itsn2	UTSW	12	4639670	nonsense	probably null
R1976:Itsn2	UTSW	12	4672733	splice site	probably benign
R2000:Itsn2	UTSW	12	4666176	nonsense	probably null
R2060:Itsn2	UTSW	12	4627879	missense	probably damaging	1.00
R2119:Itsn2	UTSW	12	4707025	missense	probably benign	0.32
R2168:Itsn2	UTSW	12	4633044	unclassified	probably benign
R2394:Itsn2	UTSW	12	4707005	missense	possibly damaging	0.86
R2860:Itsn2	UTSW	12	4700315	splice site	probably benign
R2861:Itsn2	UTSW	12	4700315	splice site	probably benign
R2900:Itsn2	UTSW	12	4630713	unclassified	probably benign
R2991:Itsn2	UTSW	12	4658474	missense	probably benign	0.01
R3087:Itsn2	UTSW	12	4666303	missense	probably damaging	1.00
R3881:Itsn2	UTSW	12	4634546	unclassified	probably benign
R4022:Itsn2	UTSW	12	4624927	missense	probably damaging	1.00
R4332:Itsn2	UTSW	12	4712611	missense	possibly damaging	0.72
R4657:Itsn2	UTSW	12	4713197	makesense	probably null
R4727:Itsn2	UTSW	12	4707660	missense	probably damaging	0.99
R4745:Itsn2	UTSW	12	4661944	missense	probably damaging	1.00
R4770:Itsn2	UTSW	12	4627892	missense	probably damaging	1.00
R4905:Itsn2	UTSW	12	4634583	unclassified	probably benign
R5269:Itsn2	UTSW	12	4633553	unclassified	probably benign
R5314:Itsn2	UTSW	12	4627960	missense	probably benign	0.09
R5345:Itsn2	UTSW	12	4672783	missense	probably damaging	1.00
R5399:Itsn2	UTSW	12	4653535	missense	probably benign	0.22
R5566:Itsn2	UTSW	12	4626554	missense	probably damaging	1.00
R5725:Itsn2	UTSW	12	4630767	unclassified	probably benign
R5773:Itsn2	UTSW	12	4707089	missense	probably damaging	1.00
R6116:Itsn2	UTSW	12	4629939	unclassified	probably benign
R6254:Itsn2	UTSW	12	4624982	splice site	probably null
R6325:Itsn2	UTSW	12	4706351	missense	probably damaging	1.00
R6361:Itsn2	UTSW	12	4629655	missense	probably benign	0.18
R6456:Itsn2	UTSW	12	4629923	unclassified	probably benign
R6854:Itsn2	UTSW	12	4652382	missense	probably benign	0.37
R6941:Itsn2	UTSW	12	4629641	missense	probably benign	0.05
R6961:Itsn2	UTSW	12	4673420	nonsense	probably null
R7326:Itsn2	UTSW	12	4632985	missense	unknown
R7387:Itsn2	UTSW	12	4639781	missense	probably damaging	1.00
R7465:Itsn2	UTSW	12	4706983	nonsense	probably null
R7471:Itsn2	UTSW	12	4708198	missense	probably benign	0.43
R7814:Itsn2	UTSW	12	4658561	missense	probably benign	0.14
R7854:Itsn2	UTSW	12	4701276	missense	probably damaging	1.00
R7879:Itsn2	UTSW	12	4701265	missense	probably benign	0.16
R7990:Itsn2	UTSW	12	4635629	missense	unknown
R8009:Itsn2	UTSW	12	4664553	missense	probably benign	0.12
R8115:Itsn2	UTSW	12	4673602	missense	possibly damaging	0.90
R8143:Itsn2	UTSW	12	4633003	missense	unknown
R8248:Itsn2	UTSW	12	4662052	missense	probably benign	0.00
R8735:Itsn2	UTSW	12	4671474	missense	probably damaging	1.00
R8748:Itsn2	UTSW	12	4701337	missense	probably benign	0.36
R9018:Itsn2	UTSW	12	4658091	missense	possibly damaging	0.57
R9386:Itsn2	UTSW	12	4629730	missense	unknown
R9681:Itsn2	UTSW	12	4633499	missense	unknown
Z1088:Itsn2	UTSW	12	4712472	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGTTGATGGAGCAGCAGC -3'
(R):5'- ACTGGGCCTCACTTGCATATG -3'

Sequencing Primer
(F):5'- TTGATGGAGCAGCAGCAGAGG -3'
(R):5'- GGGCCTCACTTGCATATGATACAG -3'

Posted On

2018-06-06