Incidental Mutation 'R6494:Setdb2'
ID522977
Institutional Source Beutler Lab
Gene Symbol Setdb2
Ensembl Gene ENSMUSG00000071350
Gene NameSET domain, bifurcated 2
SynonymsKMT1F, LOC239122
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.588) question?
Stock #R6494 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location59402009-59440884 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59402414 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 676 (Y676F)
Ref Sequence ENSEMBL: ENSMUSP00000093450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000161459]
Predicted Effect probably benign
Transcript: ENSMUST00000095775
AA Change: Y676F

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: Y676F

DomainStartEndE-ValueType
Pfam:MBD 164 236 3.4e-10 PFAM
Pfam:Pre-SET 250 362 1.7e-17 PFAM
SET 370 694 9.33e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159640
Predicted Effect probably benign
Transcript: ENSMUST00000161459
AA Change: Y660F

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: Y660F

DomainStartEndE-ValueType
Pfam:MBD 148 220 2.7e-9 PFAM
Pfam:Pre-SET 233 346 1.3e-19 PFAM
SET 354 678 9.33e-32 SMART
Meta Mutation Damage Score 0.0937 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,924 N419S possibly damaging Het
Akt2 T C 7: 27,616,349 L52P possibly damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chic2 T C 5: 75,044,282 E6G probably benign Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Col5a2 C A 1: 45,378,327 D1363Y probably damaging Het
Csmd1 C T 8: 16,211,695 probably null Het
Dnah7b A T 1: 46,099,431 Y211F probably damaging Het
Efcab3 A T 11: 105,100,019 Y5460F possibly damaging Het
Efcab6 T A 15: 84,044,322 probably null Het
Eno4 T A 19: 58,962,794 Y237N probably damaging Het
Fer1l4 T A 2: 156,045,470 D602V probably benign Het
Fgfr2 T C 7: 130,198,550 N337S probably damaging Het
Fras1 C T 5: 96,759,564 R3203C possibly damaging Het
Gbp2 T A 3: 142,632,008 V295E probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Hyal4 A G 6: 24,765,746 I366M possibly damaging Het
Itsn2 C T 12: 4,634,792 R448* probably null Het
Klhl35 G T 7: 99,472,899 W69L probably damaging Het
Kpnb1 T C 11: 97,181,648 I154V probably benign Het
Lax1 T A 1: 133,680,448 Y185F probably damaging Het
Mmp12 C T 9: 7,353,479 P208L probably damaging Het
Ndufb8 C T 19: 44,555,305 V33M probably null Het
Nptn T G 9: 58,623,752 C169G probably damaging Het
Nuggc A T 14: 65,648,222 E766V probably damaging Het
Olfr1117-ps1 A T 2: 87,309,176 N149I possibly damaging Het
Olfr1150-ps1 A T 2: 87,357,632 K63* probably null Het
Pcdhga6 T A 18: 37,708,541 I438N probably damaging Het
Pkn2 T C 3: 142,803,668 N721S possibly damaging Het
Pole T C 5: 110,324,722 W1590R possibly damaging Het
Prph2 A G 17: 46,911,081 T129A probably benign Het
Ptpro A T 6: 137,382,642 K403N probably benign Het
Rbck1 T C 2: 152,330,966 D54G possibly damaging Het
Serpinb7 T A 1: 107,435,346 L80* probably null Het
Skint1 G T 4: 112,010,712 C12F probably benign Het
Slc22a26 T A 19: 7,802,286 D55V probably damaging Het
Slc9a8 G A 2: 167,424,291 V63I probably damaging Het
Sox2 T A 3: 34,651,097 S228T probably benign Het
Spg11 A G 2: 122,113,225 S149P probably damaging Het
Tbc1d19 T A 5: 53,829,383 S45T probably benign Het
Tsacc T C 3: 88,295,396 E11G probably benign Het
Ttc7b C T 12: 100,495,407 A104T possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp108 T A 7: 24,261,357 F458I probably damaging Het
Zfp616 A T 11: 74,085,192 K762N probably damaging Het
Other mutations in Setdb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Setdb2 APN 14 59415792 missense probably damaging 1.00
IGL01695:Setdb2 APN 14 59402293 utr 3 prime probably benign
IGL01720:Setdb2 APN 14 59423436 missense possibly damaging 0.76
IGL02003:Setdb2 APN 14 59413490 missense probably damaging 0.98
IGL02023:Setdb2 APN 14 59431158 missense probably damaging 1.00
IGL02108:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02113:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02114:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02115:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02116:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02117:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02141:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02148:Setdb2 APN 14 59402315 missense probably damaging 1.00
R0419:Setdb2 UTSW 14 59406744 splice site probably null
R0610:Setdb2 UTSW 14 59417470 missense possibly damaging 0.55
R0636:Setdb2 UTSW 14 59406704 missense probably benign 0.40
R0890:Setdb2 UTSW 14 59419220 missense possibly damaging 0.89
R0931:Setdb2 UTSW 14 59423496 splice site probably benign
R1355:Setdb2 UTSW 14 59417441 missense probably damaging 1.00
R1553:Setdb2 UTSW 14 59417485 missense probably benign 0.04
R1968:Setdb2 UTSW 14 59419409 missense probably damaging 1.00
R2472:Setdb2 UTSW 14 59419454 missense possibly damaging 0.49
R2894:Setdb2 UTSW 14 59426467 missense probably benign 0.00
R3919:Setdb2 UTSW 14 59419167 missense probably damaging 1.00
R4609:Setdb2 UTSW 14 59415704 missense probably damaging 1.00
R4629:Setdb2 UTSW 14 59409359 missense probably benign 0.13
R4816:Setdb2 UTSW 14 59413646 missense probably benign 0.05
R4864:Setdb2 UTSW 14 59409266 missense probably benign 0.01
R4951:Setdb2 UTSW 14 59402303 missense possibly damaging 0.72
R5040:Setdb2 UTSW 14 59415707 missense probably damaging 0.99
R5245:Setdb2 UTSW 14 59426494 missense probably null 0.00
R5358:Setdb2 UTSW 14 59409436 missense probably benign 0.17
R5656:Setdb2 UTSW 14 59419118 missense probably damaging 1.00
R5705:Setdb2 UTSW 14 59423365 missense possibly damaging 0.80
R6103:Setdb2 UTSW 14 59409532 splice site probably null
R6106:Setdb2 UTSW 14 59423449 nonsense probably null
R6388:Setdb2 UTSW 14 59424697 missense probably benign
R6431:Setdb2 UTSW 14 59419056 missense probably damaging 1.00
R6971:Setdb2 UTSW 14 59415740 missense probably damaging 1.00
R7442:Setdb2 UTSW 14 59419251 missense probably damaging 0.99
R7444:Setdb2 UTSW 14 59423345 nonsense probably null
R7759:Setdb2 UTSW 14 59419364 missense probably damaging 1.00
R8021:Setdb2 UTSW 14 59423384 nonsense probably null
R8039:Setdb2 UTSW 14 59402375 missense probably damaging 1.00
X0017:Setdb2 UTSW 14 59419468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGATGAGTGCCCTTATTTTGC -3'
(R):5'- GCAAAACTCCGTTCCACATG -3'

Sequencing Primer
(F):5'- ATGAGTGCCCTTATTTTGCTTCTAAC -3'
(R):5'- CCTTCTTACATAGGATTTTGGGAGAC -3'
Posted On2018-06-06