Incidental Mutation 'R6494:Nuggc'
ID522979
Institutional Source Beutler Lab
Gene Symbol Nuggc
Ensembl Gene ENSMUSG00000061356
Gene Namenuclear GTPase, germinal center associated
SynonymsGm600, SLIP-GC, LOC239151
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6494 (G1)
Quality Score116.008
Status Validated
Chromosome14
Chromosomal Location65598546-65648531 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65648222 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 766 (E766V)
Ref Sequence ENSEMBL: ENSMUSP00000118402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079469] [ENSMUST00000150897]
Predicted Effect probably damaging
Transcript: ENSMUST00000079469
AA Change: E782V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078434
Gene: ENSMUSG00000061356
AA Change: E782V

DomainStartEndE-ValueType
Pfam:Dynamin_N 119 372 2.2e-15 PFAM
low complexity region 406 421 N/A INTRINSIC
Blast:AAA 434 739 4e-14 BLAST
coiled coil region 758 792 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150897
AA Change: E766V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118402
Gene: ENSMUSG00000061356
AA Change: E766V

DomainStartEndE-ValueType
Pfam:Dynamin_N 103 356 6.1e-16 PFAM
low complexity region 390 405 N/A INTRINSIC
Blast:AAA 418 723 4e-14 BLAST
coiled coil region 742 776 N/A INTRINSIC
Meta Mutation Damage Score 0.0958 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased somatic mutation frequency immunoglobulin and non-immunoglobulin loci in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,924 N419S possibly damaging Het
Akt2 T C 7: 27,616,349 L52P possibly damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chic2 T C 5: 75,044,282 E6G probably benign Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Col5a2 C A 1: 45,378,327 D1363Y probably damaging Het
Csmd1 C T 8: 16,211,695 probably null Het
Dnah7b A T 1: 46,099,431 Y211F probably damaging Het
Efcab3 A T 11: 105,100,019 Y5460F possibly damaging Het
Efcab6 T A 15: 84,044,322 probably null Het
Eno4 T A 19: 58,962,794 Y237N probably damaging Het
Fer1l4 T A 2: 156,045,470 D602V probably benign Het
Fgfr2 T C 7: 130,198,550 N337S probably damaging Het
Fras1 C T 5: 96,759,564 R3203C possibly damaging Het
Gbp2 T A 3: 142,632,008 V295E probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Hyal4 A G 6: 24,765,746 I366M possibly damaging Het
Itsn2 C T 12: 4,634,792 R448* probably null Het
Klhl35 G T 7: 99,472,899 W69L probably damaging Het
Kpnb1 T C 11: 97,181,648 I154V probably benign Het
Lax1 T A 1: 133,680,448 Y185F probably damaging Het
Mmp12 C T 9: 7,353,479 P208L probably damaging Het
Ndufb8 C T 19: 44,555,305 V33M probably null Het
Nptn T G 9: 58,623,752 C169G probably damaging Het
Olfr1117-ps1 A T 2: 87,309,176 N149I possibly damaging Het
Olfr1150-ps1 A T 2: 87,357,632 K63* probably null Het
Pcdhga6 T A 18: 37,708,541 I438N probably damaging Het
Pkn2 T C 3: 142,803,668 N721S possibly damaging Het
Pole T C 5: 110,324,722 W1590R possibly damaging Het
Prph2 A G 17: 46,911,081 T129A probably benign Het
Ptpro A T 6: 137,382,642 K403N probably benign Het
Rbck1 T C 2: 152,330,966 D54G possibly damaging Het
Serpinb7 T A 1: 107,435,346 L80* probably null Het
Setdb2 T A 14: 59,402,414 Y676F probably benign Het
Skint1 G T 4: 112,010,712 C12F probably benign Het
Slc22a26 T A 19: 7,802,286 D55V probably damaging Het
Slc9a8 G A 2: 167,424,291 V63I probably damaging Het
Sox2 T A 3: 34,651,097 S228T probably benign Het
Spg11 A G 2: 122,113,225 S149P probably damaging Het
Tbc1d19 T A 5: 53,829,383 S45T probably benign Het
Tsacc T C 3: 88,295,396 E11G probably benign Het
Ttc7b C T 12: 100,495,407 A104T possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp108 T A 7: 24,261,357 F458I probably damaging Het
Zfp616 A T 11: 74,085,192 K762N probably damaging Het
Other mutations in Nuggc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Nuggc APN 14 65623207 missense probably damaging 1.00
IGL01403:Nuggc APN 14 65623186 missense probably benign 0.01
IGL01413:Nuggc APN 14 65638581 missense probably benign 0.23
IGL02588:Nuggc APN 14 65617777 splice site probably benign
R0102:Nuggc UTSW 14 65613551 missense probably null 1.00
R0102:Nuggc UTSW 14 65613551 missense probably null 1.00
R0395:Nuggc UTSW 14 65613472 nonsense probably null
R0827:Nuggc UTSW 14 65608891 missense probably damaging 1.00
R1496:Nuggc UTSW 14 65624133 missense probably damaging 0.96
R1861:Nuggc UTSW 14 65642001 splice site probably benign
R1986:Nuggc UTSW 14 65641921 missense probably damaging 0.98
R1995:Nuggc UTSW 14 65611174 missense probably benign 0.02
R2283:Nuggc UTSW 14 65638612 missense possibly damaging 0.89
R2317:Nuggc UTSW 14 65624142 missense possibly damaging 0.81
R3799:Nuggc UTSW 14 65619638 missense probably benign 0.00
R3980:Nuggc UTSW 14 65619093 critical splice donor site probably null
R4303:Nuggc UTSW 14 65611172 missense possibly damaging 0.77
R4431:Nuggc UTSW 14 65611210 missense probably benign 0.19
R4734:Nuggc UTSW 14 65623230 missense probably damaging 1.00
R5095:Nuggc UTSW 14 65635090 nonsense probably null
R5108:Nuggc UTSW 14 65638680 missense probably damaging 0.99
R5360:Nuggc UTSW 14 65638626 missense probably damaging 1.00
R5547:Nuggc UTSW 14 65641881 missense possibly damaging 0.87
R5636:Nuggc UTSW 14 65648188 nonsense probably null
R6922:Nuggc UTSW 14 65617643 missense probably damaging 1.00
R6971:Nuggc UTSW 14 65608856 missense probably benign 0.04
R7124:Nuggc UTSW 14 65608802 missense probably damaging 1.00
R7273:Nuggc UTSW 14 65619608 missense probably damaging 0.99
R7282:Nuggc UTSW 14 65617623 missense probably damaging 1.00
R7578:Nuggc UTSW 14 65648174 missense probably damaging 1.00
R7670:Nuggc UTSW 14 65613526 missense probably damaging 1.00
R7780:Nuggc UTSW 14 65645041 missense probably damaging 1.00
R7871:Nuggc UTSW 14 65623251 missense probably benign 0.01
R8250:Nuggc UTSW 14 65641869 missense probably benign 0.10
R8329:Nuggc UTSW 14 65641282 missense probably benign 0.01
R8334:Nuggc UTSW 14 65645029 missense probably benign 0.04
R8463:Nuggc UTSW 14 65613562 missense probably damaging 1.00
R8503:Nuggc UTSW 14 65641348 critical splice donor site probably null
R8737:Nuggc UTSW 14 65645086 missense probably benign 0.00
R8861:Nuggc UTSW 14 65610035 critical splice donor site probably null
RF019:Nuggc UTSW 14 65648264 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTATTTGCAAAACAAGGGGC -3'
(R):5'- AGTTCACTCAGGATAACAGGGG -3'

Sequencing Primer
(F):5'- AGGGGCTAGGATAATCTGATTATTC -3'
(R):5'- TTAGACAAAAGCCCCTCCT -3'
Posted On2018-06-06